Search result for sequence:
TACGGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGTTGTCTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTGGAAACTGGGCAACTTGAGTACGGGAGAGGAAAGTGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
dongzhaigang national nature reserve0.500000
mudflat0.500000
north east pacific ocean0.500000
depth 1000-2000m0.500000
LOWER IN depth 2000-3000m0.500000
hainan autonomous prefecture0.400000
oil seep0.400000
mangrove swamp0.333333
marine sediment0.250000
depth 0-20cm0.222222
ocean0.111111
pacific ocean0.105263
sediment0.080000
soil0.030769
china0.018519
Fraction of dbbact annotations with this term covered by the query
TermScore
dongzhaigang national nature reserve0.500000
mudflat0.500000
north east pacific ocean0.500000
depth 1000-2000m0.500000
LOWER IN depth 2000-3000m0.500000
hainan autonomous prefecture0.333333
oil seep0.333333
mangrove swamp0.250000
marine sediment0.142857
depth 0-20cm0.142857
ocean0.062500
pacific ocean0.058824
sediment0.043478
soil0.015873
china0.009434
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment1.000000
china0.500000
soil0.500000
mangrove swamp0.500000
depth 0-20cm0.500000
hainan autonomous prefecture0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
ocean0.500000
sediment0.500000
oil seep0.500000
north east pacific ocean0.500000
pacific ocean0.500000
depth 1000-2000m0.500000
LOWER IN depth 2000-3000m0.500000

Problems / suggestions? Please email info AT dbbact DOT org