Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCAGAATTACTGGGCGTAAAGAGCGCGTAGGCGGTTATTTAAGTCAGATGTGAAATCCCTGGGCTCAACCTAGGAACTGCATTTGAAACTAAATAACTAGAGTTTCGTAGAGGGAGGTAGAATTCTAGG
common ontology terms
term enrichment score
TermScore
cinara0.666667
cinara atlantica0.400000
cinara harmonia0.400000
cinara ponderosae0.400000
Fraction of dbbact annotations with this term covered by the query
TermScore
cinara0.500000
cinara atlantica0.500000
cinara harmonia0.500000
cinara ponderosae0.500000
Fraction of annotations for the query sequences containing the term
TermScore
cinara1.000000
cinara atlantica0.333333
cinara harmonia0.333333
cinara ponderosae0.333333
Exp. ID User ID Description Date Region Flag Sequences
68amnondominant cinara, cinara atlantica2017-02-20v4No1 / 1
68amnondominant cinara, cinara harmonia2017-02-20v4No1 / 1
68amnondominant cinara, cinara ponderosae2017-02-20v4No1 / 1

Problems / suggestions? Please email info AT dbbact DOT org