Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCAGAATTACTGGGCGTAAAGAGCGCGTAGGCGGTTATTTAAGTCAGATGTGAAATCCCTGGGCTTAACCTAGGAACTGCATTTGAAACTAAATAACTAGAGTTTCGTAGAGGGAGGTAGAATTCTAGG
common ontology terms
term enrichment score
TermScore
cinara0.666667
cinara arizonica0.181818
cinara contortae0.181818
cinara maghrebica0.181818
cinara medispinosa0.181818
cinara murrayanae0.181818
cinara nuda0.181818
cinara pini0.181818
cinara terminalis0.181818
Fraction of dbbact annotations with this term covered by the query
TermScore
cinara0.500000
cinara arizonica0.500000
cinara contortae0.500000
cinara maghrebica0.500000
cinara medispinosa0.500000
cinara murrayanae0.500000
cinara nuda0.500000
cinara pini0.500000
cinara terminalis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
cinara1.000000
cinara arizonica0.111111
cinara contortae0.111111
cinara maghrebica0.111111
cinara medispinosa0.111111
cinara murrayanae0.111111
cinara nuda0.111111
cinara pini0.111111
cinara terminalis0.111111

Problems / suggestions? Please email info AT dbbact DOT org