Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGCGCGCGTAGGTGGTTGAGTCAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCACCTGATACTGCTTGACTAGAGTACGGTAGAGGGCAGTGGAATTTCCTG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
futian national nature reserve0.500000
kandelia candel0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
leizhou nature reserve0.500000
ximendao national marine reserve0.500000
mangrove0.333333
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
guangdong province0.333333
zhejiang province0.166667
depth 0-20cm0.142857
marine sediment0.071429
rhizosphere0.031250
china0.019048
soil0.016129
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
mangrove swamp1.000000
soil0.909091
marine sediment0.909091
depth 0-20cm0.909091
mangrove0.545455
kandelia candel0.454545
zhejiang province0.363636
hainan autonomous prefecture0.363636
spartina alterniflora0.272727
futian national nature reserve0.181818
danzhou xinyinggang nature reserve0.181818
dongzhaigang national nature reserve0.181818
guangdong province0.181818
leizhou nature reserve0.181818
ximendao national marine reserve0.181818
rhizophora stylosa0.090909
mudflat0.090909
rhizosphere0.090909
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668

Problems / suggestions? Please email info AT dbbact DOT org