Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
homo sapiens0.665888
adult0.390755
feces0.341924
united states of america0.290983
saliva0.234139
child0.190883
mouth0.173688
infant0.132780
china0.119327
dentition0.101437
control0.098213
rural community0.090863
subgingival plaque0.088300
skin0.075408
state of california0.060086
brazil0.059423
city0.058731
female0.057406
ulcerative colitis0.055372
bolivia0.050000
africa0.050000
obsolete_juvenile stage0.050000
australia0.046948
hunter gatherer0.046368
state of new york0.045147
pair of nares0.044843
poland0.044643
oral cavity0.044150
state of michigan0.041072
hospital0.040863
kingdom of denmark0.040724
mouth mucosa0.040449
venezuela0.037209
amerindian0.037209
age < 3 years0.037209
crohn's disease0.036866
india0.036866
state of texas0.036419
duodenum0.036364
jiangsu province0.033195
finland0.032539
chuquisaca department0.032407
oral wash0.032233
lung0.032147
age 5-13 years0.031891
state of colorado0.031891
sweden0.031227
atlanta0.028103
central african republic0.028103
sputum0.028037
bronchial epithelium0.028037
diarrhea0.027650
united kingdom0.027523
belgium0.027149
state of florida0.025918
LOWER IN control0.023810
trachea0.023548
colombia0.023502
depth < 3mm0.023364
shallow pocket depth0.023364
bangui0.023364
san diego0.023364
stunted growth0.023364
himalayas0.023364
municipality of umea0.023364
low bmi0.023296
biopsy0.023274
guangzhou city prefecture0.023229
sichuan province0.023184
1-year-old human stage0.023184
air0.023095
shanghai district0.023095
nepal0.023095
new york city0.022962
south korea0.022745
commonwealth of pennsylvania0.022701
atlantic ocean0.022701
age0.022510
mucus0.022075
japan0.021834
italy0.021482
germany0.021030
small village0.018898
bronchus0.018868
madagascar0.018868
esophagus0.018779
tonsillectomy0.018779
homosexual0.018779
msm0.018779
shark0.018779
south florida0.018779
13-year-old human stage0.018779
LOWER IN dentition0.018692
LOWER IN high bmi0.018692
cameroon0.018605
beetle0.018605
nasopharynx0.018547
french republic0.018490
human adult stage0.018433
LOWER IN caecum0.018391
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
ulcerative colitis0.777778
hunter gatherer0.750000
trachea0.750000
small village0.750000
atlanta0.666667
bronchus0.666667
venezuela0.666667
amerindian0.666667
central african republic0.666667
colombia0.666667
tracheal aspirate0.666667
age < 3 years0.666667
madagascar0.666667
state of oklahoma0.666667
nectar0.666667
building0.666667
metabolic syndrome0.666667
arm0.666667
village0.666667
mouth0.640000
sputum0.600000
bronchial epithelium0.600000
flower0.600000
subgingival plaque0.571429
finland0.571429
saliva0.555556
homo sapiens0.543726
city0.526316
indoor0.500000
office0.500000
LOWER IN outdoor0.500000
severe0.500000
LOWER IN mild0.500000
biopsy site0.500000
bolivia0.500000
chuquisaca department0.500000
age 8-12 years0.500000
LOWER IN chronic gastritis0.500000
tissue0.500000
echinopora mammiformis0.500000
induced sputum0.500000
infant0.500000
idiopathic pulmonary fibrosis0.500000
LOWER IN schizophrenia0.500000
LOWER IN weight loss0.500000
LOWER IN weight loss diet0.500000
gaz:000521000.500000
hypopharynx0.500000
bronchial brush0.500000
depth < 3mm0.500000
shallow pocket depth0.500000
africa0.500000
bangui0.500000
esophagus0.500000
squamous esophagus0.500000
cornell university0.500000
children0.500000
LOWER IN centenerians0.500000
inflammatory bowel disease0.500000
crohn's disease0.500000
acute severe colitis0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
jinan city prefecture0.500000
oesophageal brush0.500000
oslo0.500000
india0.500000
san diego0.500000
periodontal pocket0.500000
age one week0.500000
salmonella gastroenteritis0.500000
respiratory technology dependent0.500000
mammalian milk beverage0.500000
obsolete_juvenile stage0.500000
jordan0.500000
anterior naris0.500000
tonsillectomy0.500000
LOWER IN aphthous stomatitis0.500000
age<17 years0.500000
immature stage0.500000
stunted growth0.500000
antananarivo0.500000
atherosclerosis0.500000
oropharynx0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
LOWER IN american0.500000
acute respiratory failure0.500000
endotracheal aspirate0.500000
oropharyngeal swab0.500000
recurrent tonsillitis0.500000
acute pancreatitis0.500000
pancreatitis0.500000
age 8-120.500000
6-12 year-old child stage0.500000
LOWER IN depth &gt; 3mm0.500000
LOWER IN deep pocket depth0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.858852
feces0.418660
adult0.375598
united states of america0.320574
saliva0.148325
china0.124402
child0.119617
mouth0.100478
infant0.076555
control0.074163
dentition0.057416
rural community0.047847
subgingival plaque0.047847
skin0.043062
female0.038278
state of california0.033493
brazil0.033493
city0.031100
ulcerative colitis0.028708
bolivia0.026316
africa0.026316
australia0.026316
obsolete_juvenile stage0.026316
oral cavity0.023923
pair of nares0.023923
state of new york0.023923
hunter gatherer0.023923
poland0.023923
mouth mucosa0.021531
state of michigan0.021531
kingdom of denmark0.021531
hospital0.021531
venezuela0.019139
amerindian0.019139
state of texas0.019139
crohn's disease0.019139
india0.019139
age < 3 years0.019139
duodenum0.019139
jiangsu province0.019139
LOWER IN control0.016746
chuquisaca department0.016746
age 5-13 years0.016746
state of colorado0.016746
oral wash0.016746
lung0.016746
finland0.016746
sweden0.016746
atlanta0.014354
sputum0.014354
belgium0.014354
bronchial epithelium0.014354
central african republic0.014354
diarrhea0.014354
united kingdom0.014354
state of florida0.014354
air0.011962
biopsy0.011962
new york city0.011962
age0.011962
germany0.011962
sichuan province0.011962
depth < 3mm0.011962
shallow pocket depth0.011962
bangui0.011962
italy0.011962
commonwealth of pennsylvania0.011962
trachea0.011962
shanghai district0.011962
south korea0.011962
colombia0.011962
san diego0.011962
1-year-old human stage0.011962
japan0.011962
stunted growth0.011962
guangzhou city prefecture0.011962
mucus0.011962
nepal0.011962
himalayas0.011962
low bmi0.011962
municipality of umea0.011962
atlantic ocean0.011962
research facility0.011962
rectum0.009569
nasopharynx0.009569
bronchus0.009569
esophagus0.009569
colon0.009569
1-month-old human stage0.009569
israel0.009569
human adult stage0.009569
cameroon0.009569
supragingival plaque0.009569
palatine tonsil0.009569
tonsillectomy0.009569
periodontitis0.009569
madagascar0.009569
canada0.009569
LOWER IN dentition0.009569
LOWER IN feces0.009569
Exp. ID User ID Description Date Region Flag Sequences
460amnonhigher in occupied indoor air compared to outdoor air ( high in indoor office compared to outdoor in united states of america air state of california )2019-01-12v4No1 / 1
102amnon high in hiv infection compared to control in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 4
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 5
102amnon high in control compared to periodontitis in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 7
517amnondominant homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 8
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
58amnondominant homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 10
418amnondominant ocean, tissue, coral, echinopora mammiformis2018-12-02v4No1 / 10
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 11
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
567amnoncommon homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 11
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
277amnondominant homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 14
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v4No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 14
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 15
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in feces homo sapiens sichuan province )2016-12-06v4No1 / 16
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
715amnondominant homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 18
841amnondominant homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 18
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
449amnondominant feces, homo sapiens, colombia2019-01-09v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnondominant homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 21
773amnondominant homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 21
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth adult czech republic 2020-01-09v3No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
96amnondominant homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
425amnondominant homo sapiens, duodenum, child, africa, madagascar, stunted growth, antananarivo2018-12-08v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in cheyenne native american arapaho compared to american in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 23
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
773amnondominant homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 23
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
260amnondominant homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens dentition adult brazil subgingival plaque mouth periodontitis 2018-09-13v4No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
354amnon high in sputum induced sputum compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 32
354amnon high in saliva oral wash compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 44
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
805amnon high in non-smoker compared to nicotine dependence smoker cigarette smoking in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 67
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 81
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens nasopharynx infant australia )2017-04-16v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth (water) 0cm in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 160
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 170
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 306
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 311
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 345
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth (water) 25cm in north america )2017-10-15v4No1 / 359
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
642amnon high in gill compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 434
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 755
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth (water) 200m, sediment depth 12-35cm2017-04-18v4No1 / 1659
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org