Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCTGGGCTTAACCTAGGAATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
nasopharynx0.339623
child0.294659
africa0.271186
amerindian0.235294
venezuela0.235294
hunter gatherer0.222222
stunted growth0.222222
infant0.205128
duodenum0.193548
perth0.186047
age 1-3 years0.170213
middle ear0.151899
arm0.151899
homo sapiens0.151565
recurrent otitis media0.146341
antananarivo0.146341
madagascar0.146341
central african republic0.146341
bangui0.146341
skin0.134831
age 1 year0.131868
australia0.129032
kingdom of the netherlands0.127660
LOWER IN feces0.117647
age0.109589
belgium0.107143
fiji0.102564
age 3 months0.102564
chuquisaca department0.102564
forearm0.102564
age 5-13 years0.097561
nasal cavity0.096774
bolivia0.093023
LOWER IN city0.081633
LOWER IN united states of america0.075472
rural community0.075472
stomach0.063492
middle ear rinse0.054054
anterior naris0.054054
middle ear fluid0.054054
acute transudative otitis media0.054054
age > 3 months0.054054
LOWER IN age < 3 months0.054054
maxillary sinus0.054054
ethmoid sinus0.054054
tracheal aspirate0.054054
respiratory technology dependent0.054054
uganda0.054054
pneumonia0.054054
acute respiratory illness0.054054
hypopharynx0.054054
LOWER IN age 1 week0.054054
LOWER IN bangui0.054054
LOWER IN central african republic0.054054
new delhi0.054054
state of washington0.052632
sinusoidal space0.052632
paranasal sinus0.052632
trachea0.052632
respiratory system disease0.052632
LOWER IN mouth mucosa0.052632
mucosa0.051282
sinusitis0.051282
bronchoalveolar lavage0.051282
small intestine0.051282
breast milk0.050000
bronchial epithelium0.050000
lung0.048780
kingdom of denmark0.047619
india0.047619
LOWER IN mouth0.047619
hiv infection0.045455
obsolete_juvenile stage0.044444
pair of nares0.043478
kingdom of spain0.041667
united states of america0.025532
adult0.018237
feces0.015209
LOWER IN control0.011429
control0.011364
Fraction of dbbact annotations with this term covered by the query
TermScore
middle ear0.666667
amerindian0.666667
venezuela0.666667
arm0.666667
nasopharynx0.500000
perth0.500000
fiji0.500000
age 3 months0.500000
recurrent otitis media0.500000
middle ear rinse0.500000
anterior naris0.500000
middle ear fluid0.500000
acute transudative otitis media0.500000
hunter gatherer0.500000
age > 3 months0.500000
LOWER IN age < 3 months0.500000
maxillary sinus0.500000
ethmoid sinus0.500000
tracheal aspirate0.500000
respiratory technology dependent0.500000
antananarivo0.500000
madagascar0.500000
stunted growth0.500000
central african republic0.500000
bangui0.500000
uganda0.500000
pneumonia0.500000
acute respiratory illness0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
new delhi0.500000
chuquisaca department0.500000
forearm0.500000
age 1-3 years0.333333
state of washington0.333333
sinusoidal space0.333333
paranasal sinus0.333333
trachea0.333333
africa0.333333
respiratory system disease0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
age 1 year0.285714
kingdom of the netherlands0.250000
mucosa0.250000
sinusitis0.250000
bronchoalveolar lavage0.250000
small intestine0.250000
bolivia0.250000
duodenum0.222222
child0.217391
infant0.210526
breast milk0.200000
bronchial epithelium0.200000
LOWER IN feces0.187500
lung0.166667
belgium0.142857
kingdom of denmark0.142857
LOWER IN city0.142857
india0.142857
LOWER IN mouth0.142857
australia0.117647
nasal cavity0.111111
skin0.111111
hiv infection0.111111
LOWER IN united states of america0.111111
rural community0.111111
age0.105263
obsolete_juvenile stage0.100000
pair of nares0.090909
homo sapiens0.082873
kingdom of spain0.076923
stomach0.071429
united states of america0.015000
adult0.010204
feces0.008772
LOWER IN control0.007143
control0.007092
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.885714
child0.457143
nasopharynx0.257143
africa0.228571
infant0.200000
skin0.171429
duodenum0.171429
australia0.142857
amerindian0.142857
hunter gatherer0.142857
venezuela0.142857
stunted growth0.142857
age0.114286
age 1-3 years0.114286
perth0.114286
nasal cavity0.085714
kingdom of the netherlands0.085714
age 1 year0.085714
recurrent otitis media0.085714
middle ear0.085714
belgium0.085714
adult0.085714
united states of america0.085714
antananarivo0.085714
madagascar0.085714
central african republic0.085714
bangui0.085714
arm0.085714
LOWER IN feces0.085714
fiji0.057143
age 3 months0.057143
stomach0.057143
feces0.057143
LOWER IN city0.057143
LOWER IN united states of america0.057143
age 5-13 years0.057143
bolivia0.057143
rural community0.057143
chuquisaca department0.057143
forearm0.057143
control0.028571
middle ear rinse0.028571
breast milk0.028571
kingdom of spain0.028571
anterior naris0.028571
pair of nares0.028571
middle ear fluid0.028571
obsolete_juvenile stage0.028571
acute transudative otitis media0.028571
state of washington0.028571
age > 3 months0.028571
LOWER IN age < 3 months0.028571
mucosa0.028571
sinusoidal space0.028571
paranasal sinus0.028571
sinusitis0.028571
maxillary sinus0.028571
ethmoid sinus0.028571
trachea0.028571
tracheal aspirate0.028571
respiratory technology dependent0.028571
hiv infection0.028571
uganda0.028571
bronchoalveolar lavage0.028571
bronchial epithelium0.028571
lung0.028571
pneumonia0.028571
acute respiratory illness0.028571
LOWER IN control0.028571
respiratory system disease0.028571
kingdom of denmark0.028571
hypopharynx0.028571
LOWER IN age 1 week0.028571
LOWER IN bangui0.028571
LOWER IN central african republic0.028571
new delhi0.028571
small intestine0.028571
india0.028571
LOWER IN mouth mucosa0.028571
LOWER IN mouth0.028571
Exp. ID User ID Description Date Region Flag Sequences
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 1 year)2017-10-30v4No1 / 10
605amnondominant australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 10
533amnoncommon homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 11
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 12
533amnondominant homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 12
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v3No1 / 12
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
567amnondominant belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 13
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 13
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 14
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
605amnondominant australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
227amnonhigher in age > 3 months in baby nasopharynx ( high in age age > 3 months compared to age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 83
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org