Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCTGGGCTTAACCTAGGAATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
africa0.340426
nasopharynx0.311111
child0.263736
amerindian0.259740
venezuela0.259740
hunter gatherer0.243902
stunted growth0.243902
infant0.224000
duodenum0.206897
arm0.169014
homo sapiens0.164835
antananarivo0.162162
madagascar0.162162
central african republic0.162162
bangui0.162162
kingdom of the netherlands0.150000
age 1 year0.150000
skin0.148148
LOWER IN feces0.130435
age 3 months0.117647
age0.115942
belgium0.115385
fiji0.114286
chuquisaca department0.114286
forearm0.114286
age 5-13 years0.108108
nasal cavity0.103448
bolivia0.102564
LOWER IN city0.093023
rural community0.088889
LOWER IN united states of america0.085106
stomach0.070175
anterior naris0.060606
middle ear0.060606
acute transudative otitis media0.060606
age > 3 months0.060606
LOWER IN age < 3 months0.060606
ethmoid sinus0.060606
maxillary sinus0.060606
tracheal aspirate0.060606
respiratory technology dependent0.060606
uganda0.060606
pneumonia0.060606
acute respiratory illness0.060606
hypopharynx0.060606
LOWER IN age 1 week0.060606
LOWER IN bangui0.060606
LOWER IN central african republic0.060606
new delhi0.060606
state of washington0.058824
sinusoidal space0.058824
paranasal sinus0.058824
trachea0.058824
respiratory system disease0.058824
LOWER IN mouth mucosa0.058824
mucosa0.057143
sinusitis0.057143
bronchoalveolar lavage0.057143
small intestine0.057143
breast milk0.055556
bronchial epithelium0.055556
lung0.054054
kingdom of denmark0.054054
india0.052632
LOWER IN mouth0.052632
hiv infection0.051282
pair of nares0.048780
obsolete_juvenile stage0.048780
kingdom of spain0.047619
australia0.043478
united states of america0.027523
adult0.021201
feces0.016667
LOWER IN control0.012579
Fraction of dbbact annotations with this term covered by the query
TermScore
age 3 months0.666667
amerindian0.666667
venezuela0.666667
arm0.666667
nasopharynx0.500000
fiji0.500000
anterior naris0.500000
middle ear0.500000
acute transudative otitis media0.500000
hunter gatherer0.500000
age > 3 months0.500000
LOWER IN age < 3 months0.500000
ethmoid sinus0.500000
maxillary sinus0.500000
tracheal aspirate0.500000
respiratory technology dependent0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
stunted growth0.500000
central african republic0.500000
bangui0.500000
uganda0.500000
pneumonia0.500000
acute respiratory illness0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
new delhi0.500000
chuquisaca department0.500000
forearm0.500000
kingdom of the netherlands0.333333
age 1 year0.333333
state of washington0.333333
sinusoidal space0.333333
paranasal sinus0.333333
trachea0.333333
respiratory system disease0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
mucosa0.250000
sinusitis0.250000
bronchoalveolar lavage0.250000
small intestine0.250000
bolivia0.250000
infant0.222222
duodenum0.222222
breast milk0.200000
child0.200000
bronchial epithelium0.200000
LOWER IN feces0.200000
lung0.166667
kingdom of denmark0.166667
LOWER IN city0.166667
belgium0.142857
india0.142857
rural community0.142857
LOWER IN mouth0.142857
hiv infection0.125000
LOWER IN united states of america0.125000
skin0.120000
nasal cavity0.111111
age0.105263
pair of nares0.100000
obsolete_juvenile stage0.100000
kingdom of spain0.090909
homo sapiens0.089820
stomach0.076923
australia0.066667
united states of america0.016043
adult0.011905
feces0.009569
LOWER IN control0.007812
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
child0.387097
africa0.258065
nasopharynx0.225806
infant0.225806
skin0.193548
duodenum0.193548
amerindian0.161290
hunter gatherer0.161290
venezuela0.161290
stunted growth0.161290
age0.129032
nasal cavity0.096774
kingdom of the netherlands0.096774
age 1 year0.096774
adult0.096774
belgium0.096774
united states of america0.096774
antananarivo0.096774
madagascar0.096774
central african republic0.096774
bangui0.096774
arm0.096774
LOWER IN feces0.096774
fiji0.064516
age 3 months0.064516
stomach0.064516
feces0.064516
LOWER IN city0.064516
LOWER IN united states of america0.064516
age 5-13 years0.064516
bolivia0.064516
rural community0.064516
chuquisaca department0.064516
forearm0.064516
pair of nares0.032258
anterior naris0.032258
breast milk0.032258
kingdom of spain0.032258
obsolete_juvenile stage0.032258
middle ear0.032258
acute transudative otitis media0.032258
state of washington0.032258
age > 3 months0.032258
LOWER IN age < 3 months0.032258
mucosa0.032258
sinusoidal space0.032258
paranasal sinus0.032258
sinusitis0.032258
ethmoid sinus0.032258
maxillary sinus0.032258
trachea0.032258
tracheal aspirate0.032258
respiratory technology dependent0.032258
hiv infection0.032258
uganda0.032258
bronchoalveolar lavage0.032258
bronchial epithelium0.032258
lung0.032258
pneumonia0.032258
australia0.032258
acute respiratory illness0.032258
LOWER IN control0.032258
respiratory system disease0.032258
kingdom of denmark0.032258
hypopharynx0.032258
LOWER IN age 1 week0.032258
LOWER IN bangui0.032258
LOWER IN central african republic0.032258
new delhi0.032258
small intestine0.032258
india0.032258
LOWER IN mouth mucosa0.032258
LOWER IN mouth0.032258
Exp. ID User ID Description Date Region Flag Sequences
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (highfreq homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 1 year)2017-10-30v4No1 / 10
533amnoncommon homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 11
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (highfreq homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 12
533amnonhighfreq homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 12
567amnonhighfreq pair of nares, anterior naris, homo sapiens, adult, belgium2019-12-05v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
285amnonhigh freq. in effluent from middle ear (highfreq homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
227amnonhigher in age > 3 months in baby nasopharynx ( high in age age > 3 months compared to age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (highfreq homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
567amnonhighfreq nasopharynx, homo sapiens, adult, belgium2019-12-05v4No1 / 16
567amnonhighfreq ethmoid sinus, maxillary sinus, homo sapiens, adult, belgium2019-12-05v4No1 / 19
468amnonhigh freq. in trachea of children with respiratory technology dependence (highfreq homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
425amnonhighfreq homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
425amnonhighfreq homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
258amnonhigh freq. in lungs of hiv patients with pneumonia (highfreq homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
425amnonhighfreq homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 83
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org