Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATGACTGGGCGTAAAGGGCATGTAGGCGGATGATTAAGTTAGGTGTGAAAGCCCCGAGCTCAACTTGGGAATTGCACTTAAAACTGGTCGTCTGGAGTATTGTAGAGGAAGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
butterfly0.780083
costa rica0.244186
heliconius erato0.166667
tropical and subtropical moist broadleaf forest biome0.166667
panama0.133333
whole body0.105263
forest ecosystem0.105263
body proper0.095238
pareuptychia ocirrhoe0.074074
two-banded satyr butterfly0.074074
caligo illioneus0.074074
illioneus giant owl butterfly0.074074
urbanus teleus0.074074
mechanitis polymnia0.074074
orange-spotted tiger clearwing butterfly0.074074
marpesia merops0.074074
adelpha cytherea0.074074
smooth-banded sister butterfly0.074074
marpesia petreus0.074074
ruddy daggerwing butterfly0.074074
archaeoprepona demophon0.074074
banded king shoemaker butterfly0.074074
cithaerias pireta0.074074
blushing phantom butterfly0.074074
caligo brasiliensis0.074074
brazilian owl butterfly0.074074
pseudodebis zimri0.074074
heliconius cydno0.074074
cydno longwing butterfly0.074074
heliconius sara0.074074
sara longwing butterfly0.074074
outdoor0.074074
caligo atreus0.074074
yellow-edged giant owl butterfly0.074074
taygetis laches0.074074
cissia terrestris0.074074
air0.069767
digestive system0.068515
state of california0.049180
pyrisitia nise0.038462
mimosa yellow butterfly0.038462
aphrissa boisduvalii0.038462
phoebis argante0.038462
apricot sulphur butterfly0.038462
aeria eurimedia0.038462
pierella helvina0.038462
red-washed satyr butterfly0.038462
anartia fatima0.038462
banded peacock butterfly0.038462
dulcedo polita0.038462
indoor0.038462
office0.038462
chlosyne gaudialis0.038462
LOWER IN pupa0.038462
arawacus togarna0.038462
fruit feeding0.038462
LOWER IN nectar feeding0.038462
LOWER IN shelled egg0.037736
adult0.011299
united states of america0.007673
Fraction of dbbact annotations with this term covered by the query
TermScore
butterfly0.666667
pareuptychia ocirrhoe0.500000
two-banded satyr butterfly0.500000
caligo illioneus0.500000
illioneus giant owl butterfly0.500000
urbanus teleus0.500000
mechanitis polymnia0.500000
orange-spotted tiger clearwing butterfly0.500000
pyrisitia nise0.500000
mimosa yellow butterfly0.500000
marpesia merops0.500000
aphrissa boisduvalii0.500000
adelpha cytherea0.500000
smooth-banded sister butterfly0.500000
marpesia petreus0.500000
ruddy daggerwing butterfly0.500000
archaeoprepona demophon0.500000
banded king shoemaker butterfly0.500000
cithaerias pireta0.500000
blushing phantom butterfly0.500000
phoebis argante0.500000
apricot sulphur butterfly0.500000
aeria eurimedia0.500000
pierella helvina0.500000
red-washed satyr butterfly0.500000
caligo brasiliensis0.500000
brazilian owl butterfly0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
dulcedo polita0.500000
pseudodebis zimri0.500000
heliconius cydno0.500000
cydno longwing butterfly0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
outdoor0.500000
indoor0.500000
office0.500000
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
taygetis laches0.500000
cissia terrestris0.500000
chlosyne gaudialis0.500000
LOWER IN pupa0.500000
arawacus togarna0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
LOWER IN shelled egg0.333333
panama0.200000
costa rica0.142857
whole body0.111111
forest ecosystem0.111111
body proper0.090909
air0.083333
state of california0.041667
digestive system0.035714
adult0.005988
united states of america0.004098
Fraction of annotations for the query sequences containing the term
TermScore
butterfly0.940000
digestive system0.840000
costa rica0.840000
body proper0.100000
adult0.100000
panama0.100000
heliconius erato0.100000
whole body0.100000
tropical and subtropical moist broadleaf forest biome0.100000
forest ecosystem0.100000
united states of america0.060000
air0.060000
state of california0.060000
pareuptychia ocirrhoe0.040000
two-banded satyr butterfly0.040000
caligo illioneus0.040000
illioneus giant owl butterfly0.040000
urbanus teleus0.040000
mechanitis polymnia0.040000
orange-spotted tiger clearwing butterfly0.040000
marpesia merops0.040000
adelpha cytherea0.040000
smooth-banded sister butterfly0.040000
marpesia petreus0.040000
ruddy daggerwing butterfly0.040000
archaeoprepona demophon0.040000
banded king shoemaker butterfly0.040000
cithaerias pireta0.040000
blushing phantom butterfly0.040000
caligo brasiliensis0.040000
brazilian owl butterfly0.040000
pseudodebis zimri0.040000
heliconius cydno0.040000
cydno longwing butterfly0.040000
heliconius sara0.040000
sara longwing butterfly0.040000
outdoor0.040000
caligo atreus0.040000
yellow-edged giant owl butterfly0.040000
taygetis laches0.040000
cissia terrestris0.040000
pyrisitia nise0.020000
mimosa yellow butterfly0.020000
aphrissa boisduvalii0.020000
phoebis argante0.020000
apricot sulphur butterfly0.020000
aeria eurimedia0.020000
pierella helvina0.020000
red-washed satyr butterfly0.020000
anartia fatima0.020000
banded peacock butterfly0.020000
dulcedo polita0.020000
indoor0.020000
office0.020000
chlosyne gaudialis0.020000
LOWER IN pupa0.020000
LOWER IN shelled egg0.020000
arawacus togarna0.020000
fruit feeding0.020000
LOWER IN nectar feeding0.020000
Exp. ID User ID Description Date Region Flag Sequences
501amnondominant digestive system, costa rica, butterfly, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v4No1 / 5
501amnondominant digestive system, costa rica, butterfly, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 6
501amnoncommon digestive system, costa rica, butterfly, urbanus teleus2019-03-08v4No1 / 6
501amnoncommon digestive system, costa rica, butterfly, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 6
501amnoncommon digestive system, costa rica, butterfly, pyrisitia nise, mimosa yellow butterfly2019-03-08v4No1 / 6
501amnondominant digestive system, costa rica, butterfly, marpesia merops2019-03-09v4No1 / 6
501amnoncommon digestive system, costa rica, butterfly, aphrissa boisduvalii2019-03-08v4No1 / 7
501amnondominant digestive system, costa rica, butterfly, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 7
501amnoncommon digestive system, costa rica, butterfly, marpesia merops2019-03-09v4No1 / 7
501amnondominant digestive system, costa rica, butterfly, urbanus teleus2019-03-08v4No1 / 8
501amnoncommon digestive system, costa rica, butterfly, marpesia petreus, ruddy daggerwing butterfly2019-03-08v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, marpesia petreus, ruddy daggerwing butterfly2019-03-08v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, cithaerias pireta, blushing phantom butterfly2019-03-08v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 9
501amnoncommon digestive system, costa rica, butterfly, phoebis argante, apricot sulphur butterfly2019-03-09v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, aeria eurimedia2019-03-09v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 10
501amnondominant digestive system, costa rica, butterfly, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 10
501amnoncommon digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
501amnondominant digestive system, costa rica, butterfly, dulcedo polita2019-03-08v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, pseudodebis zimri2019-03-08v4No1 / 11
501amnoncommon digestive system, costa rica, butterfly, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnoncommon digestive system, costa rica, butterfly, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
118amnoncommon in captive reared butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
501amnoncommon digestive system, costa rica, butterfly, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly2019-03-08v4No1 / 13
501amnondominant digestive system, costa rica, butterfly, taygetis laches2019-03-08v4No1 / 13
501amnondominant digestive system, costa rica, butterfly, cissia terrestris2019-03-08v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 13
118amnoncommon in wild butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in body proper panama butterfly heliconius erato whole body tropical and subtropical moist broadleaf forest biome forest ecosystem 2017-04-11v4No1 / 14
501amnondominant digestive system, costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, pseudodebis zimri2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, cissia terrestris2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, taygetis laches2019-03-08v4No1 / 15
501amnoncommon digestive system, costa rica, butterfly, cithaerias pireta, blushing phantom butterfly2019-03-08v4No1 / 15
118amnonhigh freq. in wild butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
501amnoncommon digestive system, costa rica, butterfly, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
118amnonhigh freq. in captive reared butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 19
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon digestive system, costa rica, butterfly, arawacus togarna2019-03-09v4No1 / 21
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in digestive system costa rica butterfly )2019-03-09v4No1 / 116

Problems / suggestions? Please email info AT dbbact DOT org