Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTCTTAAGTCGGATGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATCCGATACTGGGTCGCTAGAGTAAGGGAGAGGGAAGCGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
leizhou nature reserve0.666667
mangrove biome0.666667
spartina alterniflora0.500000
guangdong province0.500000
mangrove swamp0.400000
depth 0-20cm0.333333
marine sediment0.133333
soil0.036364
china0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
leizhou nature reserve0.500000
mangrove biome0.500000
spartina alterniflora0.333333
guangdong province0.333333
mangrove swamp0.250000
depth 0-20cm0.200000
marine sediment0.071429
soil0.018519
china0.010417
Fraction of annotations for the query sequences containing the term
TermScore
spartina alterniflora1.000000
leizhou nature reserve1.000000
guangdong province1.000000
mangrove biome1.000000
depth 0-20cm1.000000
marine sediment1.000000
mangrove swamp1.000000
soil1.000000
china1.000000

Problems / suggestions? Please email info AT dbbact DOT org