Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATAGCATTTGAAACTGGCAGACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG
common ontology terms
term enrichment score
TermScore
ocean0.259740
sea water0.248869
coral0.235294
mangrove swamp0.194030
atlantic ocean0.182243
south florida0.156250
marine sediment0.154150
state of florida0.150289
shark0.142857
beach0.142857
water0.137384
pacific ocean0.129159
mucus0.126437
depth 0-20cm0.118919
spartina alterniflora0.102564
china0.100457
hawaii0.100000
skin0.098765
state of california0.098522
sediment0.088496
mangrove0.081301
sand0.075188
united states of america0.073028
zhejiang province0.072464
guinea0.068966
depth 3m0.068966
green turtle0.068966
chelonia mydas0.068966
gulf of mexico0.068966
pearl harbor0.068966
kandelia candel0.068966
hainan autonomous prefecture0.066667
cloaca0.062500
intestine0.054054
monterey bay0.053333
skeleton0.052632
tissue0.052632
galaxea astreata0.052632
pavona varians0.052632
bermuda0.052632
hydroides elegans0.052632
tubeworm0.052632
futian national nature reserve0.052632
LOWER IN sea water0.050633
research facility0.049689
LOWER IN water0.048193
rhizosphere0.046512
summer0.044444
saline marsh0.035714
porites lobata0.035714
portunus trituberculatus0.035714
horse crab0.035714
balaenoptera acutorostrata0.035714
minke whale0.035714
phocoena phocoena0.035714
harbor porpoise0.035714
anal canal0.035714
balaenoptera physalus0.035714
fin whale0.035714
shenzhen city prefecture0.035714
echinopora mammiformis0.035714
neritic zone0.035714
biofilm material0.035714
metal0.035714
outer biofilm0.035714
pelagic zone0.035714
delphinus delphis0.035714
trichodesmium0.035714
romania0.035714
ursu lake0.035714
depth 0-3m0.035714
mixolimnion0.035714
depth 4m0.035714
aerosol0.035714
nan'ao island0.035714
santa cruz province0.035714
shrimp farm0.035714
san francisco bay0.035714
danzhou xinyinggang nature reserve0.035714
dongzhaigang national nature reserve0.035714
mudflat0.035714
leizhou nature reserve0.035714
ximendao national marine reserve0.035714
shelled egg0.035398
gill0.035088
age 21 days0.035088
lake water0.035088
low salinity0.035088
lytechinus variegatus0.035088
guangdong province0.035088
litopenaeus vannamei0.034483
pacific white shrimp0.034483
juvenile organism0.034483
saline water0.034483
zebra fish0.033898
state of oregon0.033898
danio rerio0.033333
biofilm0.033333
lake0.033333
autumn0.031250
Fraction of dbbact annotations with this term covered by the query
TermScore
spartina alterniflora0.666667
monterey bay0.666667
saline marsh0.500000
porites lobata0.500000
skeleton0.500000
portunus trituberculatus0.500000
horse crab0.500000
pocillopora damicornis0.500000
tissue0.500000
balaenoptera acutorostrata0.500000
minke whale0.500000
phocoena phocoena0.500000
harbor porpoise0.500000
galaxea astreata0.500000
south florida0.500000
shark0.500000
anal canal0.500000
diploastrea heliopora0.500000
seriatopora caliendrum0.500000
pavona varians0.500000
balaenoptera physalus0.500000
fin whale0.500000
shenzhen city prefecture0.500000
turbinaria reniformis0.500000
echinopora mammiformis0.500000
guinea0.500000
depth 3m0.500000
green turtle0.500000
chelonia mydas0.500000
gulf of mexico0.500000
neritic zone0.500000
isopora palifera0.500000
acropora hyacinthus0.500000
biofilm material0.500000
metal0.500000
outer biofilm0.500000
pelagic zone0.500000
physeter catodon0.500000
steno bredanensis0.500000
rough-toothed dolphin0.500000
delphinus delphis0.500000
symphyllia0.500000
peponocephala electra0.500000
lagenorhynchus acutus0.500000
stenella attenuata0.500000
hawaii0.500000
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
bermuda0.500000
porites astreoides0.500000
state of rhode island0.500000
fish sauce0.500000
beginning0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
trichodesmium0.500000
sargasso sea0.500000
balaenoptera borealis0.500000
sei whale0.500000
mangrove swamp0.500000
LOWER IN 10 cm depth0.500000
LOWER IN 20 cm depth0.500000
microbial mat0.500000
red sea0.500000
anthozoa0.500000
black band disease0.500000
south pacific ocean0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
LOWER IN depth 4-9m0.500000
LOWER IN monimolimnion0.500000
LOWER IN hypersaline water0.500000
gainesville, fl0.500000
depth 4m0.500000
beach0.500000
aerosol0.500000
indian ocean0.500000
shore0.500000
kelp forest0.500000
ecklonia radiata0.500000
algae0.500000
marine biome0.500000
nan'ao island0.500000
depth 0cm0.500000
santa cruz province0.500000
tubeworm tube0.500000
shrimp farm0.500000
san francisco bay0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
east china sea0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
santa cruz county0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.398148
ocean0.222222
china0.203704
sea water0.185185
coral0.166667
skin0.148148
atlantic ocean0.120370
state of florida0.120370
water0.120370
mangrove swamp0.120370
marine sediment0.120370
mucus0.101852
pacific ocean0.101852
soil0.101852
depth 0-20cm0.101852
south florida0.092593
state of california0.092593
shark0.083333
beach0.083333
research facility0.074074
sediment0.055556
spartina alterniflora0.055556
hawaii0.055556
sand0.046296
mangrove0.046296
zhejiang province0.046296
rhizosphere0.037037
intestine0.037037
guinea0.037037
depth 3m0.037037
green turtle0.037037
chelonia mydas0.037037
gulf of mexico0.037037
cloaca0.037037
pearl harbor0.037037
hainan autonomous prefecture0.037037
kandelia candel0.037037
skeleton0.027778
tissue0.027778
galaxea astreata0.027778
pavona varians0.027778
summer0.027778
bermuda0.027778
hydroides elegans0.027778
tubeworm0.027778
LOWER IN water0.027778
LOWER IN sea water0.027778
monterey bay0.027778
futian national nature reserve0.027778
saline marsh0.018519
porites lobata0.018519
portunus trituberculatus0.018519
horse crab0.018519
balaenoptera acutorostrata0.018519
minke whale0.018519
phocoena phocoena0.018519
harbor porpoise0.018519
anal canal0.018519
gill0.018519
balaenoptera physalus0.018519
fin whale0.018519
litopenaeus vannamei0.018519
pacific white shrimp0.018519
shenzhen city prefecture0.018519
digestive system0.018519
echinopora mammiformis0.018519
neritic zone0.018519
autumn0.018519
dentition0.018519
fish0.018519
zebra fish0.018519
danio rerio0.018519
juvenile organism0.018519
age 21 days0.018519
state of oregon0.018519
biofilm0.018519
biofilm material0.018519
metal0.018519
outer biofilm0.018519
pelagic zone0.018519
delphinus delphis0.018519
shelled egg0.018519
trichodesmium0.018519
lake0.018519
romania0.018519
ursu lake0.018519
lake water0.018519
depth 0-3m0.018519
mixolimnion0.018519
low salinity0.018519
depth 4m0.018519
air0.018519
aerosol0.018519
lytechinus variegatus0.018519
nan'ao island0.018519
santa cruz province0.018519
farm0.018519
shrimp farm0.018519
saline water0.018519
san francisco bay0.018519
Exp. ID User ID Description Date Region Flag Sequences
376amnondominant rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 8
418amnoncommon coral, ocean, porites lobata, skeleton2018-12-02v4No1 / 8
463amnondominant intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 8
418amnondominant coral, ocean, pocillopora damicornis, skeleton2018-12-02v4No1 / 9
418amnoncommon coral, ocean, porites lobata, tissue2018-12-02v4No1 / 9
79amnondominant skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
79amnondominant skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 10
418amnondominant coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 11
323amnonhigh freq. in shark cloaca (dominant atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 12
323amnonhigh freq. in shark skin (dominant atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 13
418amnondominant coral, ocean, diploastrea heliopora, mucus2018-12-02v4No1 / 14
323amnonhigh freq. in shark gills (dominant atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 15
418amnondominant coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 15
418amnondominant coral, ocean, pavona varians, mucus2018-12-02v4No1 / 15
79amnondominant skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 15
85amnondominant litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 16
418amnoncommon coral, ocean, turbinaria reniformis, tissue2018-12-02v4No1 / 16
418amnondominant coral, ocean, mucus, echinopora mammiformis2018-12-02v4No1 / 17
222amnondominant water, sea water, guinea, depth 3m2017-10-26v4No1 / 18
288amnondominant green turtle, chelonia mydas, gulf of mexico, cloaca, neritic zone, autumn2018-01-29v4No1 / 18
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v4No1 / 18
323amnonhigh freq. in shark teeth (dominant atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 19
463amnoncommon intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 19
437amnondominant fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
418amnondominant coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
79amnoncommon skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
222amnonhig hfreq. on outer biofilm on metal plate in ocean water (dominant water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 24
288amnondominant pelagic zone, cloaca, gulf of mexico, green turtle, chelonia mydas, summer2018-01-29v4No1 / 24
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 24
418amnoncommon coral, ocean, pavona varians, tissue2018-12-02v4No1 / 29
79amnoncommon skin, united states of america, physeter catodon2017-03-03v4No1 / 30
79amnoncommon skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 34
418amnoncommon coral, ocean, mucus, echinopora mammiformis2018-12-02v4No1 / 34
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
79amnondominant skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
418amnoncommon coral, ocean, symphyllia, mucus2018-12-02v4No1 / 38
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
418amnoncommon coral, ocean, galaxea astreata, skeleton2018-12-02v4No1 / 42
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 71
483amnoncommon hawaii, pearl harbor, united states of america, water, sea water, depth 1-2m2019-02-13v4No1 / 72
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
34amnonhigher in 0cm depth compared to 10cm, 20cm depth ( high in topsoil compared to 10 cm depth 20 cm depth in mangrove swamp rhizosphere china )2016-12-06v4No1 / 106
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
222amnoncommon water, sea water, guinea, depth 3m2017-10-26v4No1 / 115
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 119
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
577amnoncommon lake, romania, ursu lake, water, lake water, depth 0-3m, mixolimnion, low salinity2020-01-09v3No1 / 130
288amnoncommon green turtle, chelonia mydas, gulf of mexico, cloaca, neritic zone, autumn2018-01-29v4No1 / 132
288amnoncommon pelagic zone, cloaca, gulf of mexico, green turtle, chelonia mydas, summer2018-01-29v4No1 / 135
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
222amnoncommon on outer biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 147
376amnoncommon rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 161
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
577amnon high in depth 0-3m mixolimnion low salinity compared to depth 4-9m high salinity monimolimnion hypersaline water in lake romania ursu lake water lake water 2020-01-09v3No1 / 190
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
418amnoncommon ocean, sediment, coral reef2018-12-02v4No1 / 216
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
65amnoncommon digesta, lytechinus variegatus, state of florida2017-02-17v4No1 / 298
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
65amnoncommon feces, lytechinus variegatus, state of florida2017-02-17v4No1 / 376
77amnon high in summer compared to winter in kelp forest ecklonia radiata australia algae marine biome 2017-02-28v4No1 / 399
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
323amnoncommon water, atlantic ocean, south florida, state of florida, united states of america, surface water, depth 0cm, sea water2018-04-24v4No1 / 504
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 683
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-12v4No1 / 1038
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
473amnon high in depth 50-100m compared to depth 5-50m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1656
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070

Problems / suggestions? Please email info AT dbbact DOT org