Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATAGCATTTGAAACTGGCAGACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG
common ontology terms
term enrichment score
TermScore
ocean0.279395
sea water0.270769
coral0.257143
atlantic ocean0.200514
south florida0.173913
state of florida0.171806
shark0.159292
beach0.159292
pacific ocean0.139831
mucus0.136646
water0.131512
hawaii0.112150
skin0.111498
state of california0.105263
sediment0.097879
china0.087708
sand0.083333
united states of america0.079731
guinea0.077670
depth 3m0.077670
green turtle0.077670
chelonia mydas0.077670
gulf of mexico0.077670
pearl harbor0.077670
cloaca0.069565
intestine0.062016
monterey bay0.060302
skeleton0.059406
tissue0.059406
galaxea astreata0.059406
pavona varians0.059406
bermuda0.059406
hydroides elegans0.059406
tubeworm0.059406
LOWER IN sea water0.056872
research facility0.055363
LOWER IN water0.053812
rhizosphere0.053691
summer0.050420
saline marsh0.040404
spartina alterniflora0.040404
porites lobata0.040404
portunus trituberculatus0.040404
horse crab0.040404
balaenoptera acutorostrata0.040404
minke whale0.040404
phocoena phocoena0.040404
harbor porpoise0.040404
anal canal0.040404
balaenoptera physalus0.040404
fin whale0.040404
shenzhen city prefecture0.040404
echinopora mammiformis0.040404
neritic zone0.040404
biofilm material0.040404
metal0.040404
outer biofilm0.040404
pelagic zone0.040404
delphinus delphis0.040404
trichodesmium0.040404
depth 4m0.040404
aerosol0.040404
nan'ao island0.040404
santa cruz province0.040404
shrimp farm0.040404
san francisco bay0.040404
shelled egg0.040000
gill0.039604
age 21 days0.039604
mangrove swamp0.039604
lytechinus variegatus0.039604
saline water0.039216
litopenaeus vannamei0.038835
pacific white shrimp0.038835
juvenile organism0.038835
zebra fish0.038095
state of oregon0.038095
danio rerio0.037383
biofilm0.037383
marine sediment0.037037
autumn0.036036
fish0.034188
air0.034188
dentition0.032000
farm0.028777
digestive system0.026846
pocillopora damicornis0.020619
diploastrea heliopora0.020619
seriatopora caliendrum0.020619
turbinaria reniformis0.020619
isopora palifera0.020619
acropora hyacinthus0.020619
physeter catodon0.020619
steno bredanensis0.020619
rough-toothed dolphin0.020619
symphyllia0.020619
peponocephala electra0.020619
lagenorhynchus acutus0.020619
stenella attenuata0.020619
bobtail squid0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
monterey bay0.666667
saline marsh0.500000
spartina alterniflora0.500000
porites lobata0.500000
skeleton0.500000
portunus trituberculatus0.500000
horse crab0.500000
pocillopora damicornis0.500000
tissue0.500000
balaenoptera acutorostrata0.500000
minke whale0.500000
phocoena phocoena0.500000
harbor porpoise0.500000
galaxea astreata0.500000
south florida0.500000
shark0.500000
anal canal0.500000
diploastrea heliopora0.500000
seriatopora caliendrum0.500000
pavona varians0.500000
balaenoptera physalus0.500000
fin whale0.500000
shenzhen city prefecture0.500000
turbinaria reniformis0.500000
echinopora mammiformis0.500000
guinea0.500000
depth 3m0.500000
green turtle0.500000
chelonia mydas0.500000
gulf of mexico0.500000
neritic zone0.500000
isopora palifera0.500000
acropora hyacinthus0.500000
biofilm material0.500000
metal0.500000
outer biofilm0.500000
pelagic zone0.500000
physeter catodon0.500000
steno bredanensis0.500000
rough-toothed dolphin0.500000
delphinus delphis0.500000
symphyllia0.500000
peponocephala electra0.500000
lagenorhynchus acutus0.500000
stenella attenuata0.500000
hawaii0.500000
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
bermuda0.500000
porites astreoides0.500000
state of rhode island0.500000
fish sauce0.500000
beginning0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
trichodesmium0.500000
sargasso sea0.500000
balaenoptera borealis0.500000
sei whale0.500000
LOWER IN 10 cm depth0.500000
LOWER IN 20 cm depth0.500000
microbial mat0.500000
red sea0.500000
anthozoa0.500000
black band disease0.500000
south pacific ocean0.500000
gainesville, fl0.500000
depth 4m0.500000
beach0.500000
aerosol0.500000
indian ocean0.500000
shore0.500000
kelp forest0.500000
ecklonia radiata0.500000
algae0.500000
marine biome0.500000
nan'ao island0.500000
depth 0cm0.500000
santa cruz province0.500000
tubeworm tube0.500000
shrimp farm0.500000
san francisco bay0.500000
east china sea0.500000
santa cruz county0.500000
depth 50-100m0.500000
LOWER IN depth 5-50m0.500000
LOWER IN air0.500000
coral0.400000
shelled egg0.400000
sea water0.379310
atlantic ocean0.375000
gill0.333333
age 21 days0.333333
LOWER IN end0.333333
depth 1-2m0.333333
mangrove swamp0.333333
fish feed0.333333
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.452632
ocean0.252632
sea water0.210526
coral0.189474
skin0.168421
atlantic ocean0.136842
state of florida0.136842
china0.115789
mucus0.115789
water0.115789
pacific ocean0.115789
south florida0.105263
state of california0.105263
shark0.094737
beach0.094737
research facility0.084211
sediment0.063158
hawaii0.063158
sand0.052632
rhizosphere0.042105
intestine0.042105
guinea0.042105
depth 3m0.042105
green turtle0.042105
chelonia mydas0.042105
gulf of mexico0.042105
cloaca0.042105
pearl harbor0.042105
skeleton0.031579
tissue0.031579
galaxea astreata0.031579
pavona varians0.031579
summer0.031579
bermuda0.031579
hydroides elegans0.031579
tubeworm0.031579
LOWER IN water0.031579
LOWER IN sea water0.031579
monterey bay0.031579
saline marsh0.021053
spartina alterniflora0.021053
porites lobata0.021053
portunus trituberculatus0.021053
horse crab0.021053
balaenoptera acutorostrata0.021053
minke whale0.021053
phocoena phocoena0.021053
harbor porpoise0.021053
anal canal0.021053
gill0.021053
balaenoptera physalus0.021053
fin whale0.021053
litopenaeus vannamei0.021053
pacific white shrimp0.021053
shenzhen city prefecture0.021053
digestive system0.021053
echinopora mammiformis0.021053
neritic zone0.021053
autumn0.021053
dentition0.021053
fish0.021053
zebra fish0.021053
danio rerio0.021053
juvenile organism0.021053
age 21 days0.021053
state of oregon0.021053
biofilm0.021053
biofilm material0.021053
metal0.021053
outer biofilm0.021053
pelagic zone0.021053
delphinus delphis0.021053
shelled egg0.021053
trichodesmium0.021053
mangrove swamp0.021053
depth 4m0.021053
air0.021053
aerosol0.021053
lytechinus variegatus0.021053
nan'ao island0.021053
marine sediment0.021053
santa cruz province0.021053
farm0.021053
shrimp farm0.021053
saline water0.021053
san francisco bay0.021053
pocillopora damicornis0.010526
diploastrea heliopora0.010526
seriatopora caliendrum0.010526
turbinaria reniformis0.010526
isopora palifera0.010526
acropora hyacinthus0.010526
physeter catodon0.010526
steno bredanensis0.010526
rough-toothed dolphin0.010526
symphyllia0.010526
peponocephala electra0.010526
lagenorhynchus acutus0.010526
stenella attenuata0.010526
bobtail squid0.010526
Exp. ID User ID Description Date Region Flag Sequences
376amnonhighfreq rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 8
418amnoncommon coral, ocean, porites lobata, skeleton2018-12-02v4No1 / 8
463amnonhighfreq intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 8
418amnonhighfreq coral, ocean, pocillopora damicornis, skeleton2018-12-02v4No1 / 9
418amnoncommon coral, ocean, porites lobata, tissue2018-12-02v4No1 / 9
79amnonhighfreq skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
79amnonhighfreq skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 10
418amnonhighfreq coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 11
323amnonhigh freq. in shark cloaca (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 12
323amnonhigh freq. in shark skin (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 13
418amnonhighfreq coral, ocean, diploastrea heliopora, mucus2018-12-02v4No1 / 14
323amnonhigh freq. in shark gills (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 15
418amnonhighfreq coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 15
418amnonhighfreq coral, ocean, pavona varians, mucus2018-12-02v4No1 / 15
79amnonhighfreq skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 15
85amnonhighfreq litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 16
418amnoncommon coral, ocean, turbinaria reniformis, tissue2018-12-02v4No1 / 16
418amnonhighfreq coral, ocean, mucus, echinopora mammiformis2018-12-02v4No1 / 17
222amnonhighfreq water, sea water, guinea, depth 3m2017-10-26v4No1 / 18
288amnonhighfreq green turtle, chelonia mydas, gulf of mexico, cloaca, neritic zone, autumn2018-01-29v4No1 / 18
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v4No1 / 18
323amnonhigh freq. in shark teeth (highfreq atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 19
463amnoncommon intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 19
437amnonhighfreq fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
418amnonhighfreq coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
79amnoncommon skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
222amnonhig hfreq. on outer biofilm on metal plate in ocean water (highfreq water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 24
288amnonhighfreq pelagic zone, cloaca, gulf of mexico, green turtle, chelonia mydas, summer2018-01-29v4No1 / 24
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 24
418amnoncommon coral, ocean, pavona varians, tissue2018-12-02v4No1 / 29
79amnoncommon skin, united states of america, physeter catodon2017-03-03v4No1 / 30
79amnoncommon skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 34
418amnoncommon coral, ocean, mucus, echinopora mammiformis2018-12-02v4No1 / 34
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
79amnonhighfreq skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
418amnoncommon coral, ocean, symphyllia, mucus2018-12-02v4No1 / 38
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
418amnoncommon coral, ocean, galaxea astreata, skeleton2018-12-02v4No1 / 42
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 71
483amnoncommon hawaii, pearl harbor, united states of america, water, sea water, depth 1-2m2019-02-13v4No1 / 72
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
34amnonhigher in 0cm depth compared to 10cm, 20cm depth ( high in topsoil compared to 10 cm depth 20 cm depth in mangrove swamp rhizosphere china )2016-12-06v4No1 / 106
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
222amnoncommon water, sea water, guinea, depth 3m2017-10-26v4No1 / 115
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 119
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
288amnoncommon green turtle, chelonia mydas, gulf of mexico, cloaca, neritic zone, autumn2018-01-29v4No1 / 132
288amnoncommon pelagic zone, cloaca, gulf of mexico, green turtle, chelonia mydas, summer2018-01-29v4No1 / 135
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
222amnoncommon on outer biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 147
376amnoncommon rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 161
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
418amnoncommon ocean, sediment, coral reef2018-12-02v4No1 / 216
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
65amnoncommon digesta, lytechinus variegatus, state of florida2017-02-17v4No1 / 298
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
65amnoncommon feces, lytechinus variegatus, state of florida2017-02-17v4No1 / 376
77amnon high in summer compared to winter in kelp forest ecklonia radiata australia algae marine biome 2017-02-28v4No1 / 399
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
323amnoncommon water, atlantic ocean, south florida, state of florida, united states of america, surface water, depth 0cm, sea water2018-04-24v4No1 / 504
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 683
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-12v4No1 / 1038
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
473amnon high in depth 50-100m compared to depth 5-50m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1656
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070

Problems / suggestions? Please email info AT dbbact DOT org