Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGGTAAGTCGGATGTGAAAGCCCAGGGCTTAACCTTGGAATTGCATTCGATACTGCTTAACTAGAGTATGGTAGAGGGAAGTGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
east china sea0.400000
mangrove swamp0.333333
hainan autonomous prefecture0.333333
other regions0.250000
LOWER IN yushan islands0.250000
shrimp farm0.250000
danzhou xinyinggang nature reserve0.250000
rhizophora stylosa0.250000
dongzhaigang national nature reserve0.250000
mudflat0.250000
ximendao national marine reserve0.250000
marine sediment0.243902
depth 0-20cm0.222222
mangrove0.222222
spartina alterniflora0.222222
zhejiang province0.166667
saline water0.142857
ocean0.105263
sediment0.076923
farm0.058824
china0.055046
water0.035714
soil0.030769
Fraction of dbbact annotations with this term covered by the query
TermScore
east china sea0.500000
other regions0.500000
LOWER IN yushan islands0.500000
shrimp farm0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
ximendao national marine reserve0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
spartina alterniflora0.333333
mangrove swamp0.250000
zhejiang province0.166667
marine sediment0.142857
depth 0-20cm0.142857
saline water0.125000
ocean0.062500
sediment0.043478
farm0.035714
china0.028302
water0.020000
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
marine sediment0.833333
soil0.500000
mangrove swamp0.500000
depth 0-20cm0.500000
sediment0.333333
ocean0.333333
east china sea0.333333
hainan autonomous prefecture0.333333
other regions0.166667
LOWER IN yushan islands0.166667
farm0.166667
shrimp farm0.166667
water0.166667
saline water0.166667
danzhou xinyinggang nature reserve0.166667
mangrove0.166667
rhizophora stylosa0.166667
dongzhaigang national nature reserve0.166667
mudflat0.166667
ximendao national marine reserve0.166667
zhejiang province0.166667
spartina alterniflora0.166667

Problems / suggestions? Please email info AT dbbact DOT org