Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTTGTAAGTCGGATGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTCGATACTGCTTAACTAGAGTATGGTAGAGGGAAGTGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
mangrove swamp0.666667
kandelia candel0.444444
dongzhaigang national nature reserve0.444444
hainan autonomous prefecture0.428571
mangrove0.363636
danzhou xinyinggang nature reserve0.285714
mudflat0.285714
leizhou nature reserve0.285714
spartina alterniflora0.250000
guangdong province0.250000
depth 0-20cm0.242424
marine sediment0.131148
rhizosphere0.052632
china0.037037
soil0.031128
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
danzhou xinyinggang nature reserve0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
leizhou nature reserve0.500000
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
depth 0-20cm0.142857
marine sediment0.071429
rhizosphere0.030303
china0.018868
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
mangrove swamp1.000000
soil0.800000
marine sediment0.800000
depth 0-20cm0.800000
hainan autonomous prefecture0.600000
mangrove0.400000
kandelia candel0.400000
dongzhaigang national nature reserve0.400000
spartina alterniflora0.200000
danzhou xinyinggang nature reserve0.200000
mudflat0.200000
rhizosphere0.200000
guangdong province0.200000
leizhou nature reserve0.200000

Problems / suggestions? Please email info AT dbbact DOT org