Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGATAAGCCGGTTGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATCCGGAACTGTCAGGCTAGAGTGCAGGAGAGGAAGGTAGAATTCCCGG
common ontology terms
term enrichment score
TermScore
hawaii0.153846
citrus0.142857
china0.136965
adult0.125874
homo sapiens0.115496
water0.113208
sea water0.102710
digestive system0.100000
research facility0.093437
feces0.092697
leaf0.086022
city0.083333
africa0.083333
state of florida0.083333
child0.080925
root0.080537
fishmeal diet0.080000
india0.080000
oncorhynchus mykiss0.076923
rainbow trout0.076923
duodenum0.075472
zoological garden0.074074
state of tennessee0.074074
hong kong0.067797
sweden0.066667
skin0.066667
united states of america0.066188
LOWER IN feces0.064000
surface water0.063492
rhizosphere0.062827
marine sediment0.062827
zebra fish0.061538
fish0.060606
danio rerio0.059701
sediment0.056872
air0.051948
shore0.051724
coastal water0.051724
new delhi0.051724
termite0.051724
reticulitermes flaviceps0.051724
age 130.051724
philippine sea0.051724
whole plant0.050420
commonwealth of massachusetts0.050420
woodland area0.049793
rural community0.049793
juvenile organism0.049180
forest ecosystem0.048583
subgingival plaque0.048000
germany0.047431
mouse0.046693
canada0.045802
intestine0.044944
atlantic ocean0.044776
state of california0.043321
mus musculus0.043165
antibiotic0.042857
obsolete_juvenile stage0.042857
saliva0.040678
pacific ocean0.037267
soil0.037267
colon0.035928
organic material0.035088
forest biome0.035088
tetragonula fuscobalteata0.035088
terrestrial biome0.035088
achatinella mustelina0.035088
environmental system determined by an organism0.035088
centris atripes0.035088
subway0.035088
fvb/n mice0.035088
bobtail squid0.035088
euprymna scolopes0.035088
loxodonta africana0.035088
african elephant0.035088
douchi0.035088
stunted growth0.035088
vero beach, fl0.035088
guinea0.035088
depth 3m0.035088
antananarivo0.035088
madagascar0.035088
ft. pierce, fl0.035088
immokalee, fl0.035088
quincy, fl0.035088
gainesville, fl0.035088
age 50-60 years0.035088
nanning city prefecture0.035088
cambridgeshire0.035088
triturus cristatus0.035088
oryctolagus cuniculus0.035088
quesnel lake0.035088
age 5-13 years0.035088
chuquisaca department0.035088
forearm0.035088
cebus capucinus0.034483
white-faced capuchin0.034483
mouth neoplasm0.034483
cancer0.034483
Fraction of dbbact annotations with this term covered by the query
TermScore
amsterdam0.500000
clindamycin0.500000
vancomycin0.500000
hawaii0.500000
organic material0.500000
forest biome0.500000
tetragonula fuscobalteata0.500000
shore0.500000
terrestrial biome0.500000
achatinella mustelina0.500000
environmental system determined by an organism0.500000
centris atripes0.500000
hong kong0.500000
subway0.500000
coastal water0.500000
new delhi0.500000
mustela putorius furo0.500000
ferret0.500000
LOWER IN defatted larvae insect diet0.500000
fvb/n mice0.500000
ailurus fulgens0.500000
red panda0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
shell gland0.500000
bobtail squid0.500000
euprymna scolopes0.500000
loxodonta africana0.500000
african elephant0.500000
egg jelly0.500000
douchi0.500000
termite0.500000
reticulitermes flaviceps0.500000
LOWER IN wood diet0.500000
waste water0.500000
xinxiang city prefecture0.500000
root structure0.500000
africa0.500000
stunted growth0.500000
vero beach, fl0.500000
guinea0.500000
depth 3m0.500000
wood diet0.500000
LOWER IN mulch diet0.500000
antananarivo0.500000
madagascar0.500000
central african republic0.500000
bangui0.500000
ft. pierce, fl0.500000
age 130.500000
biofilm material0.500000
metal0.500000
outer biofilm0.500000
immokalee, fl0.500000
chitin beads0.500000
quincy, fl0.500000
spondyloarthritis0.500000
spondylitis0.500000
gainesville, fl0.500000
photic zone0.500000
philippine sea0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
pan troglodytes0.500000
chimpanzee0.500000
cambridgeshire0.500000
triturus cristatus0.500000
LOWER IN achatinella mustelina0.500000
oryctolagus cuniculus0.500000
rabbit0.500000
quesnel lake0.500000
age 5-13 years0.500000
chuquisaca department0.500000
forearm0.500000
guangdong province0.500000
subtropical broadleaf forest biome0.500000
LOWER IN mouth mucosa0.500000
east china sea0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
field soil0.500000
nicotiana tabacum0.500000
brackish water0.500000
caspian sea0.500000
sample depth 12-35cm0.500000
contaminated sediment0.500000
heavy metal0.500000
ph 7-90.500000
whole plant0.333333
fishmeal diet0.333333
commonwealth of massachusetts0.333333
india0.333333
cebus capucinus0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.272727
united states of america0.245455
homo sapiens0.227273
research facility0.190909
china0.145455
adult0.136364
water0.100000
hawaii0.090909
digestive system0.090909
citrus0.090909
state of florida0.090909
sea water0.081818
leaf0.072727
child0.063636
mouse0.054545
mus musculus0.054545
city0.054545
root0.054545
rhizosphere0.054545
LOWER IN control0.045455
fish0.045455
oncorhynchus mykiss0.045455
rainbow trout0.045455
sweden0.045455
fishmeal diet0.045455
india0.045455
zoological garden0.045455
state of tennessee0.045455
africa0.045455
duodenum0.045455
skin0.045455
danio rerio0.036364
zebra fish0.036364
intestine0.036364
marine sediment0.036364
air0.036364
hong kong0.036364
surface water0.036364
LOWER IN feces0.036364
sediment0.036364
saliva0.027273
antibiotic0.027273
whole plant0.027273
forest ecosystem0.027273
shore0.027273
atlantic ocean0.027273
coastal water0.027273
commonwealth of massachusetts0.027273
new delhi0.027273
woodland area0.027273
germany0.027273
state of california0.027273
termite0.027273
reticulitermes flaviceps0.027273
colon0.027273
subgingival plaque0.027273
obsolete_juvenile stage0.027273
age 130.027273
juvenile organism0.027273
rural community0.027273
canada0.027273
pacific ocean0.027273
philippine sea0.027273
soil0.027273
organic material0.018182
forest biome0.018182
tetragonula fuscobalteata0.018182
terrestrial biome0.018182
achatinella mustelina0.018182
environmental system determined by an organism0.018182
larval stage0.018182
centris atripes0.018182
subway0.018182
monkey0.018182
cebus capucinus0.018182
costa rica0.018182
white-faced capuchin0.018182
fvb/n mice0.018182
bobtail squid0.018182
euprymna scolopes0.018182
loxodonta africana0.018182
african elephant0.018182
douchi0.018182
food (fermented)0.018182
control0.018182
stunted growth0.018182
vero beach, fl0.018182
guinea0.018182
depth 3m0.018182
small intestine0.018182
antananarivo0.018182
madagascar0.018182
ft. pierce, fl0.018182
immokalee, fl0.018182
quincy, fl0.018182
mouth neoplasm0.018182
cancer0.018182
gainesville, fl0.018182
fresh water0.018182
age 50-60 years0.018182
Exp. ID User ID Description Date Region Flag Sequences
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
113amnonhighfreq danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
28amnonhigh freq. in leaves in hawaii (highfreq hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 7
59amnonhighfreq tetragonula fuscobalteata, digestive system2017-02-02v4No1 / 7
93amnonhigh freq. in marine sediment near the shore in hawaii (highfreq hawaii, shore, marine sediment)2017-03-12v4No1 / 7
28amnonhighfreq hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 8
59amnoncommon tetragonula fuscobalteata, digestive system2017-02-02v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
113amnonhighfreq danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 10
59amnonhighfreq centris atripes, digestive system2017-02-03v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (highfreq air, hong kong, city, subway)2019-01-20v4No1 / 11
461amnonhighfreq water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 13
475amnonhigh freq. in air next to subway stations in hong kong (highfreq air, hong kong, city)2019-01-20v4No1 / 14
352amnonhighfreq homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (highfreq monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
248amnonhighfreq mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
93amnoncommon hawaii, shell gland, bobtail squid, euprymna scolopes2017-03-12v4No1 / 28
399amnonhighfreq feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 28
93amnoncommon hawaii, bobtail squid, euprymna scolopes, egg jelly, shelled egg2017-03-12v4No1 / 29
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi china food (fermented) )2017-03-08v4No1 / 30
57amnoncommon apis mellifera, digestive system, state of california, forager2017-01-31v4No1 / 33
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
222amnoncommon water, sea water, guinea, depth 3m2017-10-26v4No1 / 115
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
222amnoncommon on outer biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
169amnoncommon lake, fresh water, water, canada, depth 0-1 meter, photic zone2017-07-24v4No1 / 234
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 252
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 323
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
416amnoncommon termite, reticulitermes flaviceps, colon, research facility, united states of america2018-11-30v4No1 / 511
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
507amnoncommon lake sediment, sediment, canada, quesnel lake, province of british columbia, sediment depth 8-10cm2019-03-17v4No1 / 651
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133

Problems / suggestions? Please email info AT dbbact DOT org