Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGATAAGCCGGTTGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATCCGGAACTGTCAGGCTAGAGTGCAGGAGAGGAAGGTAGAATTCCCGG
common ontology terms
term enrichment score
TermScore
hawaii0.145985
citrus0.136054
china0.131148
adult0.128552
homo sapiens0.112824
water0.105431
sea water0.098765
digestive system0.095087
research facility0.085453
feces0.082428
leaf0.081218
city0.078431
fishmeal diet0.075758
africa0.075758
state of florida0.074906
india0.074349
root0.074074
rhizosphere0.073043
oncorhynchus mykiss0.072993
rainbow trout0.072993
duodenum0.071685
child0.070886
state of tennessee0.070423
hong kong0.064000
skin0.061728
united states of america0.061047
LOWER IN feces0.060606
surface water0.060150
sweden0.059880
zoological garden0.059880
marine sediment0.058968
zebra fish0.058394
danio rerio0.056738
belgium0.055172
fish0.054945
sediment0.054176
soil0.051414
air0.049689
canada0.049383
shore0.048780
coastal water0.048780
new delhi0.048780
termite0.048780
reticulitermes flaviceps0.048780
age 130.048780
philippine sea0.048780
whole plant0.047619
woodland area0.047059
juvenile organism0.046512
forest ecosystem0.045977
rural community0.045977
commonwealth of massachusetts0.045455
subgingival plaque0.045455
germany0.044444
mouse0.043956
atlantic ocean0.042553
state of california0.041237
obsolete_juvenile stage0.040816
mus musculus0.040816
intestine0.040609
antibiotic0.040000
saliva0.037736
pacific ocean0.035714
colon0.034483
organic material0.033058
forest biome0.033058
tetragonula fuscobalteata0.033058
terrestrial biome0.033058
achatinella mustelina0.033058
environmental system determined by an organism0.033058
centris atripes0.033058
subway0.033058
maxillary sinus0.033058
ethmoid sinus0.033058
fvb/n mice0.033058
bobtail squid0.033058
euprymna scolopes0.033058
loxodonta africana0.033058
african elephant0.033058
douchi0.033058
stunted growth0.033058
vero beach, fl0.033058
guinea0.033058
depth 3m0.033058
antananarivo0.033058
madagascar0.033058
ft. pierce, fl0.033058
quzhou county0.033058
days 1800.033058
mature barley plants0.033058
immokalee, fl0.033058
quincy, fl0.033058
gainesville, fl0.033058
age 50-60 years0.033058
nanning city prefecture0.033058
spring0.033058
cambridgeshire0.033058
triturus cristatus0.033058
quesnel lake0.033058
chuquisaca department0.033058
Fraction of dbbact annotations with this term covered by the query
TermScore
canada0.666667
amsterdam0.500000
clindamycin0.500000
vancomycin0.500000
hawaii0.500000
organic material0.500000
forest biome0.500000
tetragonula fuscobalteata0.500000
shore0.500000
terrestrial biome0.500000
achatinella mustelina0.500000
environmental system determined by an organism0.500000
centris atripes0.500000
hong kong0.500000
subway0.500000
maxillary sinus0.500000
ethmoid sinus0.500000
coastal water0.500000
new delhi0.500000
mustela putorius furo0.500000
ferret0.500000
LOWER IN defatted larvae insect diet0.500000
anterior naris0.500000
fvb/n mice0.500000
ailurus fulgens0.500000
red panda0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
shell gland0.500000
bobtail squid0.500000
euprymna scolopes0.500000
loxodonta africana0.500000
african elephant0.500000
egg jelly0.500000
douchi0.500000
termite0.500000
reticulitermes flaviceps0.500000
LOWER IN wood diet0.500000
waste water0.500000
xinxiang city prefecture0.500000
root structure0.500000
stunted growth0.500000
vero beach, fl0.500000
guinea0.500000
depth 3m0.500000
wood diet0.500000
LOWER IN mulch diet0.500000
antananarivo0.500000
madagascar0.500000
central african republic0.500000
bangui0.500000
ft. pierce, fl0.500000
age 130.500000
quzhou county0.500000
days 1800.500000
mature barley plants0.500000
biofilm material0.500000
metal0.500000
outer biofilm0.500000
immokalee, fl0.500000
chitin beads0.500000
quincy, fl0.500000
spondyloarthritis0.500000
spondylitis0.500000
gainesville, fl0.500000
photic zone0.500000
philippine sea0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
spring0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
cambridgeshire0.500000
triturus cristatus0.500000
LOWER IN achatinella mustelina0.500000
quesnel lake0.500000
chuquisaca department0.500000
forearm0.500000
subtropical broadleaf forest biome0.500000
east china sea0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
field soil0.500000
nicotiana tabacum0.500000
brackish water0.500000
caspian sea0.500000
sample depth 12-35cm0.500000
contaminated sediment0.500000
heavy metal0.500000
ph 7-90.500000
oryctolagus cuniculus0.400000
contaminant0.333333
whole plant0.333333
fishmeal diet0.333333
cebus capucinus0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.256410
homo sapiens0.247863
united states of america0.230769
research facility0.179487
adult0.162393
china0.153846
water0.094017
hawaii0.085470
digestive system0.085470
citrus0.085470
state of florida0.085470
sea water0.076923
leaf0.068376
child0.059829
rhizosphere0.059829
mouse0.051282
mus musculus0.051282
city0.051282
root0.051282
LOWER IN control0.042735
fish0.042735
oncorhynchus mykiss0.042735
rainbow trout0.042735
sweden0.042735
fishmeal diet0.042735
india0.042735
zoological garden0.042735
state of tennessee0.042735
africa0.042735
duodenum0.042735
soil0.042735
skin0.042735
danio rerio0.034188
zebra fish0.034188
intestine0.034188
marine sediment0.034188
air0.034188
hong kong0.034188
belgium0.034188
surface water0.034188
LOWER IN feces0.034188
sediment0.034188
saliva0.025641
antibiotic0.025641
whole plant0.025641
forest ecosystem0.025641
shore0.025641
atlantic ocean0.025641
coastal water0.025641
commonwealth of massachusetts0.025641
new delhi0.025641
woodland area0.025641
germany0.025641
state of california0.025641
termite0.025641
reticulitermes flaviceps0.025641
colon0.025641
subgingival plaque0.025641
obsolete_juvenile stage0.025641
age 130.025641
juvenile organism0.025641
rural community0.025641
canada0.025641
pacific ocean0.025641
philippine sea0.025641
organic material0.017094
forest biome0.017094
tetragonula fuscobalteata0.017094
terrestrial biome0.017094
achatinella mustelina0.017094
environmental system determined by an organism0.017094
larval stage0.017094
centris atripes0.017094
subway0.017094
maxillary sinus0.017094
ethmoid sinus0.017094
monkey0.017094
cebus capucinus0.017094
costa rica0.017094
white-faced capuchin0.017094
fvb/n mice0.017094
bobtail squid0.017094
euprymna scolopes0.017094
loxodonta africana0.017094
african elephant0.017094
douchi0.017094
food (fermented)0.017094
control0.017094
stunted growth0.017094
vero beach, fl0.017094
guinea0.017094
depth 3m0.017094
small intestine0.017094
antananarivo0.017094
madagascar0.017094
ft. pierce, fl0.017094
biochar0.017094
zhejiang province0.017094
quzhou county0.017094
depth 15cm0.017094
Exp. ID User ID Description Date Region Flag Sequences
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
277amnonhigher in blanks compared to nasopharynx (contamination)2019-12-05v4No1 / 5
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
28amnonhigh freq. in leaves in hawaii (dominant hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 7
59amnondominant tetragonula fuscobalteata, digestive system2017-02-02v4No1 / 7
93amnonhigh freq. in marine sediment near the shore in hawaii (dominant hawaii, shore, marine sediment)2017-03-12v4No1 / 7
28amnondominant hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 8
59amnoncommon tetragonula fuscobalteata, digestive system2017-02-02v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 10
59amnondominant centris atripes, digestive system2017-02-03v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v4No1 / 11
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
461amnondominant water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 13
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v4No1 / 14
352amnondominant homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
93amnoncommon hawaii, shell gland, bobtail squid, euprymna scolopes2017-03-12v4No1 / 28
399amnondominant feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 28
93amnoncommon hawaii, bobtail squid, euprymna scolopes, egg jelly, shelled egg2017-03-12v4No1 / 29
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi china food (fermented) )2017-03-08v4No1 / 30
57amnoncommon apis mellifera, digestive system, state of california, forager2017-01-31v4No1 / 33
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
222amnoncommon water, sea water, guinea, depth 3m2017-10-26v4No1 / 115
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
628sheryoHigher in bulk soil with barley plants after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in bulk soil china zhejiang province quzhou county soil depth 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 140
222amnoncommon on outer biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
169amnoncommon lake, fresh water, water, canada, depth 0-1 meter, photic zone2017-07-24v4No1 / 234
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 252
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 323
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
416amnoncommon termite, reticulitermes flaviceps, colon, research facility, united states of america2018-11-30v4No1 / 511
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
507amnoncommon lake sediment, sediment, canada, quesnel lake, province of british columbia, sediment depth 8-10cm2019-03-17v4No1 / 651
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133

Problems / suggestions? Please email info AT dbbact DOT org