Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGCAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTCGAACTGGCAAACTAGAGTGTGATAGAGGGTGGTAGAATTTCAGG
common ontology terms
term enrichment score
TermScore
sea water0.425126
pacific ocean0.412439
ocean0.320000
water0.226046
skin0.223672
state of california0.215633
saline water0.150376
calvert island0.145749
alga0.138776
atlantic ocean0.136409
province of british columbia0.135849
monterey bay0.128480
fish farm0.113821
united states of america0.111493
surface water0.095712
canada0.095012
beach0.094421
south florida0.094421
state of florida0.088608
shark0.086580
marine sediment0.085354
ria formosa0.078603
open water pond0.078603
china0.077980
portuguese republic0.075630
hawaii0.069264
sediment0.066237
french republic0.062745
pearl harbor0.062222
english channel coastal waters of france0.062222
aquarium0.061269
foodon product type0.054299
gill0.054299
army ant0.053812
gaster0.053812
hydroides elegans0.053812
tubeworm0.053812
haliotis sorenseni0.053812
white abalone0.053812
dicentrarchus labrax0.053812
seabass0.053812
research facility0.052668
mucus0.051724
japan0.046875
trichodesmium0.045249
philippine sea0.045249
cambridgeshire0.045249
hokkaido0.044248
newt0.044248
air0.041494
depth 0-20cm0.041494
rhizosphere0.040134
stomach0.039088
united kingdom0.036900
foot0.036866
zostera marina0.036866
aerosol0.036530
nan'ao island0.036530
estuary0.036530
red abalone0.036530
haliotis rufescens0.036530
bodega bay0.036530
north east pacific ocean0.036530
oil seep0.035874
mangrove swamp0.035242
commonwealth of virginia0.034632
city0.032680
wild0.030888
mastocarpus0.027842
lu'an city prefecture0.027650
flowerpot0.027650
cheese food product0.027650
camembert cheese food product0.027650
spartina alterniflora0.027650
sparus aurata0.027650
seabream0.027650
shell0.027650
sea urchin0.027650
bermuda0.027650
swan goose0.027650
lissotriton vulgaris0.027650
san francisco bay0.027650
antarctic peninsula0.027273
megaptera novaeangliae0.027273
humpback whale0.027273
lytechinus variegatus0.027273
anser cygnoides0.027273
marine eelgrass0.027273
depth 1000-2000m0.027273
greenhouse0.026906
antarctica0.026549
larval stage0.025862
sand0.025862
root0.025696
bird0.024896
adult0.023582
soil0.022548
feces0.019584
rana catesbeiana0.018692
bullfrog0.018692
Fraction of dbbact annotations with this term covered by the query
TermScore
ocean0.687500
sea water0.685714
pacific ocean0.666667
monterey bay0.666667
foot0.666667
zostera marina0.666667
mastocarpus0.666667
rana catesbeiana0.666667
bullfrog0.666667
foodon product type0.600000
gill0.600000
surface water0.583333
lu'an city prefecture0.500000
dendrobium officinale0.500000
flowerpot0.500000
linepithema humile0.500000
argentine ant0.500000
favites abdita0.500000
eciton burchellii0.500000
army ant0.500000
gaster0.500000
labidus praedator0.500000
rind0.500000
cheese food product0.500000
camembert cheese food product0.500000
neivamyrmex0.500000
beach0.500000
aerosol0.500000
south pacific ocean0.500000
trichodesmium0.500000
spartina alterniflora0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
haliotis sorenseni0.500000
white abalone0.500000
harbor seal0.500000
phoca vitulina0.500000
balaenoptera acutorostrata0.500000
minke whale0.500000
phocoena phocoena0.500000
harbor porpoise0.500000
sargasso sea0.500000
curd0.500000
anal canal0.500000
south florida0.500000
shark0.500000
nan'ao island0.500000
low tide zone0.500000
LOWER IN high tide zone0.500000
calvert island0.500000
alga0.500000
endocladia0.500000
endocladia muricata0.500000
sparus aurata0.500000
ria formosa0.500000
open water pond0.500000
seabream0.500000
english channel coastal waters of france0.500000
shell0.500000
philippine sea0.500000
starfish0.500000
asterias amurensis0.500000
shenzhen city prefecture0.500000
santa cruz county0.500000
stenella attenuata0.500000
eelgrass0.500000
eagle harbor0.500000
sea urchin0.500000
pseudacris crucifer0.500000
peeper0.500000
bermuda0.500000
dicentrarchus labrax0.500000
seabass0.500000
steno bredanensis0.500000
rough-toothed dolphin0.500000
saccharina groenlandica0.500000
saccharina0.500000
lagenorhynchus acutus0.500000
porites astreoides0.500000
swan goose0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
patiria pectinifera0.500000
nereocystis0.500000
kelp0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
upright gametophyte0.500000
LOWER IN crustose sporophyte0.500000
mastocarpus alaskensis0.500000
balaenoptera borealis0.500000
sei whale0.500000
north pacific ocean0.500000
balaenoptera physalus0.500000
fin whale0.500000
fire salamander0.500000
LOWER IN depth 0m0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.355450
sea water0.308057
pacific ocean0.298578
ocean0.208531
skin0.189573
state of california0.189573
water0.184834
research facility0.109005
china0.099526
canada0.094787
saline water0.094787
province of british columbia0.085308
calvert island0.085308
atlantic ocean0.080569
alga0.080569
monterey bay0.071090
state of florida0.066351
fish farm0.066351
beach0.052133
south florida0.052133
marine sediment0.052133
surface water0.052133
shark0.047393
sediment0.042654
portuguese republic0.042654
ria formosa0.042654
open water pond0.042654
hawaii0.037915
french republic0.037915
feces0.037915
pearl harbor0.033175
aquarium0.033175
english channel coastal waters of france0.033175
adult0.033175
rhizosphere0.028436
mucus0.028436
stomach0.028436
army ant0.028436
gaster0.028436
foodon product type0.028436
hydroides elegans0.028436
tubeworm0.028436
haliotis sorenseni0.028436
white abalone0.028436
gill0.028436
japan0.028436
dicentrarchus labrax0.028436
seabass0.028436
air0.023697
trichodesmium0.023697
philippine sea0.023697
city0.023697
hokkaido0.023697
cambridgeshire0.023697
newt0.023697
united kingdom0.023697
depth 0-20cm0.023697
soil0.023697
aerosol0.018957
foot0.018957
nan'ao island0.018957
wild0.018957
zostera marina0.018957
commonwealth of virginia0.018957
estuary0.018957
red abalone0.018957
haliotis rufescens0.018957
bodega bay0.018957
homo sapiens0.018957
oil seep0.018957
north east pacific ocean0.018957
mangrove swamp0.018957
greenhouse0.014218
lu'an city prefecture0.014218
flowerpot0.014218
antarctica0.014218
antarctic peninsula0.014218
megaptera novaeangliae0.014218
humpback whale0.014218
cheese food product0.014218
camembert cheese food product0.014218
spartina alterniflora0.014218
sparus aurata0.014218
seabream0.014218
shell0.014218
lytechinus variegatus0.014218
sea urchin0.014218
bermuda0.014218
larval stage0.014218
anser cygnoides0.014218
bird0.014218
swan goose0.014218
lissotriton vulgaris0.014218
mastocarpus0.014218
root0.014218
marine eelgrass0.014218
san francisco bay0.014218
depth 1000-2000m0.014218
sand0.014218
dendrobium officinale0.009479
Exp. ID User ID Description Date Region Flag Sequences
809amnondominant research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 3
182amnondominant body proper, argentina, linepithema humile, argentine ant2017-08-15v4No1 / 5
418amnoncommon ocean, mucus, coral, favites abdita2018-12-02v4No1 / 5
183amnoncommon stomach, eciton burchellii, army ant, gaster2017-08-15v4No1 / 6
183amnoncommon stomach, army ant, gaster, labidus praedator2017-08-15v4No1 / 6
275amnonlower in fall 2010 compared to summer 2013 in whale skin ( high in summer compared to autumn in skin antarctica antarctic peninsula megaptera novaeangliae humpback whale )2018-01-16v4No1 / 6
418amnondominant ocean, mucus, coral, favites abdita2018-12-02v4No1 / 6
74amnondominant united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
182amnoncommon body proper, argentina, linepithema humile, argentine ant2017-08-15v4No1 / 7
183amnoncommon stomach, army ant, gaster, neivamyrmex2017-08-15v4No1 / 7
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 7
136amnondominant ocean, sea water, pacific ocean, south pacific ocean, trichodesmium2017-04-17v4No1 / 8
376amnondominant united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean2018-09-11v4No1 / 8
483amnondominant united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 8
308amnondominant united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 10
79amnondominant united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 10
79amnondominant united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
79amnondominant united states of america, skin, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 10
136amnondominant ocean, sea water, atlantic ocean, sargasso sea, trichodesmium2017-04-17v4No1 / 11
183amnondominant stomach, eciton burchellii, army ant, gaster2017-08-15v4No1 / 11
74amnoncommon united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 12
323amnonhigh freq. in shark cloaca (dominant united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 12
504amnondominant sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 12
323amnonhigh freq. in shark skin (dominant united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 13
355amnon high in low tide zone compared to high tide zone in ocean pacific ocean canada province of british columbia calvert island alga endocladia endocladia muricata 2018-08-01v4No1 / 13
782amnondominant fish farm, skin, portuguese republic, sparus aurata, ria formosa, open water pond, seabream2021-05-07v4No1 / 13
183amnondominant stomach, army ant, gaster, labidus praedator2017-08-15v4No1 / 14
183amnondominant stomach, army ant, gaster, neivamyrmex2017-08-15v4No1 / 14
676amnondominant fish farm, saline water, sea water, aquarium, french republic, english channel coastal waters of france2028-02-27v4No1 / 14
308amnondominant united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 15
323amnonhigh freq. in shark gills (dominant united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 15
342amnondominant water, sea water, pacific ocean, philippine sea, depth 150m2018-05-28v4No1 / 15
342amnondominant water, sea water, pacific ocean, philippine sea, depth 300m2018-05-28v4No1 / 15
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, asterias amurensis, japan2019-08-18v4No1 / 15
74amnoncommon united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 16
85amnondominant digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 16
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 16
79amnondominant united states of america, skin, stenella attenuata2017-03-03v4No1 / 16
235amnoncommon in eelgrass leaf (common ocean, leaf, zostera marina, eelgrass)2017-11-07v4No1 / 18
351amnondominant feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 18
504amnondominant water, sea water, nan'ao island, china2019-03-14v4No1 / 18
99amnondominant united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 19
275amnondominant skin, antarctica, antarctic peninsula, megaptera novaeangliae, humpback whale2018-01-16v4No1 / 19
323amnonhigh freq. in shark teeth (dominant united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 19
9amnondominant sea water, bermuda2016-10-27v4No1 / 20
550amnondominant city, sea water, hokkaido, japan2019-08-18v4No1 / 20
483amnondominant united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 21
782amnondominant fish farm, skin, portuguese republic, dicentrarchus labrax, ria formosa, open water pond, seabass2021-05-07v4No1 / 21
79amnoncommon united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
275amnoncommon skin, antarctica, antarctic peninsula, megaptera novaeangliae, humpback whale2018-01-16v4No1 / 26
79amnoncommon united states of america, skin, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
79amnondominant united states of america, skin, delphinus delphis2017-03-03v4No1 / 36
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 39
79amnoncommon united states of america, skin, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
782amnoncommon fish farm, skin, portuguese republic, sparus aurata, ria formosa, open water pond, seabream2021-05-07v4No1 / 52
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v4No1 / 61
417amnoncommon feces, mongolia, anser cygnoides, summer, bird, swan goose2018-12-01v4No1 / 68
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
483amnoncommon united states of america, water, sea water, hawaii, pearl harbor, depth 1-2m2019-02-13v4No1 / 72
782amnoncommon fish farm, skin, portuguese republic, dicentrarchus labrax, ria formosa, open water pond, seabass2021-05-07v4No1 / 72
483amnoncommon united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 80
136amnoncommon ocean, sea water, atlantic ocean, sargasso sea, trichodesmium2017-04-17v4No1 / 81
782amnoncommon fish farm, gill, portuguese republic, dicentrarchus labrax, ria formosa, open water pond, seabass2021-05-07v4No1 / 82
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to late timepoint fresh food spoilage in foodon product type china )2018-01-09v4No1 / 83
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, patiria pectinifera, japan2019-08-18v4No1 / 85
318amnoncommon ocean, vancouver, pacific ocean, canada, nereocystis, kelp2018-04-16v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
355amnonlower in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in upright gametophyte compared to crustose sporophyte in ocean pacific ocean canada province of british columbia calvert island mastocarpus alga mastocarpus alaskensis )2018-08-01v4No1 / 86
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
9amnoncommon sea water, bermuda2016-10-27v4No1 / 91
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in united states of america atlantic ocean state of florida south florida shark )2018-04-24v4No1 / 98
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
483amnoncommon united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 100
136amnoncommon ocean, sea water, pacific ocean, north pacific ocean, trichodesmium2017-04-17v4No1 / 103
79amnoncommon united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth 0m in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
461amnonearly colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts, chitin beads, middle timepoints)2019-01-12v4No1 / 108
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 110
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
323amnoncommon freq. in shark teeth (common united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 123
136amnoncommon ocean, sea water, pacific ocean, south pacific ocean, trichodesmium2017-04-17v4No1 / 125
355amnoncommon in upright gametophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, upright gametophyte)2018-08-01v4No1 / 129
417amnon high in winter china compared to mongolia summer in feces anser cygnoides bird swan goose 2018-12-01v4No1 / 132
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to late time points depth 0m in water sea water mediterranean sea depth 2000-3000m )2019-03-05v4No1 / 132
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 147
355amnoncommon in rocks from high tide zone (common ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 148
510amnoncommon estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
376amnoncommon united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean2018-09-11v4No1 / 161
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 170
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 176
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 10m2019-01-16v4No1 / 213
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 223
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 20m2019-01-16v4No1 / 225
505amnoncommon water, surface water, sea water, state of california, pacific ocean, free floating, size < 1um2019-03-14v4No1 / 225
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
342amnoncommon water, surface water, sea water, pacific ocean, philippine sea2018-05-28v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 237
308amnoncommon in water of aquarium with red abalone (common united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 240
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
485amnoncommon coast, water, saline water, surface water, sea water, mediterranean sea, italy, gulf of naples, depth 0-1 meter2019-02-19v4No1 / 244
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 255
308amnoncommon feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 258
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
433amnon high in indian ocean compared to coast south china sea in ocean sea water depth 4m 2018-12-19v4No1 / 283
550amnoncommon city, sea water, hokkaido, japan2019-08-18v4No1 / 291
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 30m2019-01-16v4No1 / 293
722amnoncommon united states of america, estuary, surface water, sea water, state of new york, new york city2021-01-02v4No1 / 301
782amnon high in skin compared to gill in fish farm portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-06v4No1 / 304
461amnoncommon united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 322
342amnoncommon water, sea water, pacific ocean, philippine sea, depth 300m2018-05-28v4No1 / 323
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
782amnon high in skin compared to gill in fish farm portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 325
433amnoncommon ocean, sea water, indian ocean, depth 4m2018-12-19v4No1 / 333
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 40m2019-01-16v4No1 / 340
93amnoncommon in seawater near the shore in hawaii (common shore, sea water, hawaii)2017-03-12v4No1 / 345
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 345
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
550amnon high in sea water compared to coelomic fluid wild starfish asterias amurensis in city hokkaido japan 2019-08-18v4No1 / 389
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 60m2019-01-16v4No1 / 390
676amnoncommon saline water, sea water, french republic, english channel coastal waters of france, water inlet2028-02-27v4No1 / 390
342amnoncommon water, sea water, pacific ocean, philippine sea, depth 150m2018-05-28v4No1 / 397
505amnoncommon water, surface water, sea water, state of california, pacific ocean, particle bound, size 1-80um2019-03-14v4No1 / 397
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 399
722amnon high in surface water sea water compared to sediment marine sediment sediment surface in united states of america estuary state of new york new york city 2021-01-02v4No1 / 399
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 419
782amnon high in dicentrarchus labrax seabass compared to sparus aurata seabream in fish farm skin portuguese republic ria formosa open water pond 2021-05-06v4No1 / 419
642amnon high in gill compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 434
504amnoncommon sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 437
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 444
209amnoncommon ocean, sea water, north america, depth 25cm2017-10-15v4No1 / 445
504amnoncommon water, sea water, nan'ao island, china2019-03-14v4No1 / 452
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 80m2019-01-16v4No1 / 454
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 461
676amnoncommon fish farm, saline water, sea water, aquarium, french republic, english channel coastal waters of france2028-02-27v4No1 / 465
782amnon high in dicentrarchus labrax seabass compared to sparus aurata seabream in fish farm gill portuguese republic ria formosa open water pond 2021-05-06v4No1 / 477
236amnoncommon ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 483
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 100m2019-01-16v4No1 / 486
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 200m2019-01-16v4No1 / 492
323amnoncommon united states of america, water, surface water, sea water, atlantic ocean, state of florida, south florida, depth 0cm2018-04-24v4No1 / 504
236amnoncommon ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 505
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth 5m compared to depth 300m depth 75m depth 150m in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 544
676amnon high in hot water inlet compared to cold water inlet in saline water sea water french republic english channel coastal waters of france water inlet 2028-02-27v4No1 / 551
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 558
209amnonlower in whale blow condensate compared to ocean water ( high in ocean sea water depth 25cm compared to respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow in north america )2017-10-15v4No1 / 560
138amnoncommon in ocean water depth 1000m (common ocean, sea water, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
676amnoncommon fish farm, aquarium, french republic, biofilm, english channel coastal waters of france, saline water biofilm2028-02-27v4No1 / 567
308amnoncommon united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 579
138amnoncommon in ocean water depth 150-500m (common ocean, sea water, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth 500m2019-01-16v4No1 / 587
308amnoncommon united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 592
318amnoncommon ocean, vancouver, pacific ocean, canada, mastocarpus, red alga2018-04-16v4No1 / 598
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 609
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 632
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in united states of america river water fresh water mississippi river free floating depth 1m filtered 0.2um )2019-01-07v4No1 / 652
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 667
138amnoncommon in ocean water depth 2000-4000m (common ocean, sea water, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
236amnon high in root compared to sediment marine sediment in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 674
483amnoncommon united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 683
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 1000-2000m, clayoquot slope2019-01-16v4No1 / 725
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 727
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 500-1000m, barkley canyon2019-01-16v4No1 / 990
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 1038
473amnon high in depth 50-100m compared to depth 150-500m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1072
236amnoncommon ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 1156
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1166
571amnoncommon mangrove swamp, soil, marine sediment, depth 0-20cm, mangrove, china, hainan autonomous prefecture, rhizophora stylosa, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1210
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 1218
223amnoncommon ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 1311
571amnoncommon mangrove swamp, soil, marine sediment, depth 0-20cm, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, depth 0-20cm, mudflat, china, futian national nature reserve2019-12-16v4No1 / 1587
473amnon high in depth 50-100m compared to depth 5-50m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1656
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, depth 0-20cm, china, futian national nature reserve2019-12-16v4No1 / 1747
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1799
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 1838
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
472amnon high in depth 1000-2000m compared to depth 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000
676amnon high in fish farm aquarium compared to water inlet in saline water sea water french republic english channel coastal waters of france 2028-02-27v4No1 / 3729
676amnon high in saline water sea water compared to biofilm saline water biofilm in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 4350

Problems / suggestions? Please email info AT dbbact DOT org