Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTCGGTAAGTCAGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTTGATACTGTCGGACTAGAGTTTGGTAGAGGGAAGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
mangrove biome0.666667
leizhou nature reserve0.500000
kandelia candel0.500000
ximendao national marine reserve0.500000
spartina alterniflora0.400000
guangdong province0.400000
mangrove swamp0.400000
mangrove0.400000
depth 0-20cm0.333333
zhejiang province0.285714
marine sediment0.133333
soil0.036364
china0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
leizhou nature reserve0.500000
mangrove biome0.500000
kandelia candel0.500000
ximendao national marine reserve0.500000
spartina alterniflora0.333333
guangdong province0.333333
mangrove0.333333
mangrove swamp0.250000
depth 0-20cm0.200000
zhejiang province0.200000
marine sediment0.071429
soil0.018519
china0.010417
Fraction of annotations for the query sequences containing the term
TermScore
mangrove biome1.000000
depth 0-20cm1.000000
marine sediment1.000000
mangrove swamp1.000000
soil1.000000
china1.000000
spartina alterniflora0.500000
leizhou nature reserve0.500000
guangdong province0.500000
kandelia candel0.500000
mangrove0.500000
zhejiang province0.500000
ximendao national marine reserve0.500000

Problems / suggestions? Please email info AT dbbact DOT org