Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTACGTAGGCGGCTTAATAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGTTTGGCTAGAGTGAGTGAGAGGTTAGTGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
guinea0.400000
depth 3m0.400000
biofilm material0.400000
metal0.400000
hawaii0.363636
biofilm0.250000
larval stage0.142857
sea water0.133333
water0.055556
research facility0.021858
united states of america0.012308
Fraction of dbbact annotations with this term covered by the query
TermScore
guinea0.500000
depth 3m0.500000
biofilm material0.500000
metal0.500000
hawaii0.250000
biofilm0.200000
larval stage0.090909
sea water0.083333
water0.030303
research facility0.011111
united states of america0.006211
Fraction of annotations for the query sequences containing the term
TermScore
hawaii0.666667
pearl harbor0.666667
research facility0.666667
hydroides elegans0.666667
tubeworm0.666667
united states of america0.666667
larval stage0.333333
water0.333333
sea water0.333333
guinea0.333333
depth 3m0.333333
biofilm0.333333
biofilm material0.333333
metal0.333333
tubeworm tube0.333333

Problems / suggestions? Please email info AT dbbact DOT org