Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTACGTAGGCGGCTTAATAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGTTTGGCTAGAGTGAGTGAGAGGTTAGTGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
pearl harbor0.571429
hydroides elegans0.571429
tubeworm0.571429
guinea0.400000
depth 3m0.400000
biofilm material0.400000
metal0.400000
tubeworm tube0.400000
hawaii0.307692
biofilm0.250000
larval stage0.125000
sea water0.117647
water0.042553
research facility0.020725
united states of america0.011268
Fraction of dbbact annotations with this term covered by the query
TermScore
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
guinea0.500000
depth 3m0.500000
biofilm material0.500000
metal0.500000
tubeworm tube0.500000
hawaii0.200000
biofilm0.200000
larval stage0.076923
sea water0.071429
water0.022727
research facility0.010526
united states of america0.005682
Fraction of annotations for the query sequences containing the term
TermScore
hawaii0.666667
pearl harbor0.666667
research facility0.666667
hydroides elegans0.666667
tubeworm0.666667
united states of america0.666667
larval stage0.333333
water0.333333
sea water0.333333
guinea0.333333
depth 3m0.333333
biofilm0.333333
biofilm material0.333333
metal0.333333
tubeworm tube0.333333

Problems / suggestions? Please email info AT dbbact DOT org