Search result for sequence:
TACGGAGGGTGCGAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGCCTGTTAAGTCTGGTGTTAAATGCAGATGCTCAACATCTGTTCGGCACTGGATACTGGCAAGCTTGAATGCGGTAGAGGTAAAGGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
rural community0.298507
rhesus macaque0.228571
macaca mulatta0.156863
obsolete_juvenile stage0.142857
LOWER IN age 8 months0.129032
LOWER IN republic of congo0.129032
LOWER IN nouabale-ndoki national park0.129032
LOWER IN city0.127660
india0.117647
child0.114943
belgium0.114286
chimpanzee0.114286
feces0.108208
pan troglodytes0.108108
LOWER IN duodenum0.105263
thailand0.102564
homo sapiens0.102215
3-month-old human stage0.097561
monkey0.096386
sus scrofa0.093023
pig0.093023
zoological garden0.083333
captive0.080808
LOWER IN tylosin phosphate0.068966
chepang0.068966
LOWER IN tharu0.068966
LOWER IN agrarian0.068966
himalayas0.068966
age 6 months0.068966
gannan tibetan autonomous prefecture0.068966
LOWER IN gangcha region0.068966
new delhi0.068966
antananarivo0.068966
LOWER IN bangui0.068966
china0.068966
duroc pig0.068966
age 140 days0.068966
bushbuckridge local municipality0.068966
peri-urban community0.068966
LOWER IN soweto0.068966
LOWER IN urban community0.068966
myanmar0.068966
karen0.068966
LOWER IN hmong0.068966
LOWER IN china0.068966
saint louis0.068966
saint louis zoo0.068966
tunapuco0.068966
chuquisaca department0.068966
gorilla gorilla gorilla0.068966
colon0.066667
forager0.066667
nepal0.066667
tibet autonomous region0.066667
LOWER IN colon0.066667
toronto0.066667
madagascar0.066667
LOWER IN central african republic0.066667
nanchang city prefecture0.066667
human middle aged stage0.066667
venezuela0.066667
amerindian0.066667
LOWER IN state of oklahoma0.066667
LOWER IN age 1 month0.066667
age 5-13 years0.066667
LOWER IN pan troglodytes troglodytes0.066667
age 2 months0.064516
13-year-old human stage0.064516
hunter gatherer0.064516
small village0.064516
gay0.064516
bolivia0.064516
LOWER IN heterosexual0.062500
LOWER IN msw0.062500
adult0.061180
tibetan plateau0.060606
juvenile organism0.060606
LOWER IN small intestine0.060606
egypt0.060606
peru0.060606
homosexual0.060606
msm0.060606
state of oregon0.060606
LOWER IN finland0.058824
kingdom of norway0.057143
LOWER IN mouth mucosa0.055556
hiv infection0.054054
LOWER IN wild0.053333
crohn's disease0.051282
female0.049383
south africa0.048780
sweden0.047619
LOWER IN antibiotic0.046512
LOWER IN ileum0.046512
kingdom of spain0.041667
LOWER IN mouth0.039216
africa0.038835
LOWER IN state of california0.037736
research facility0.037383
male0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN tylosin phosphate0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
himalayas0.500000
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
gannan tibetan autonomous prefecture0.500000
LOWER IN gangcha region0.500000
new delhi0.500000
antananarivo0.500000
LOWER IN bangui0.500000
china0.500000
duroc pig0.500000
age 140 days0.500000
bushbuckridge local municipality0.500000
peri-urban community0.500000
LOWER IN soweto0.500000
LOWER IN urban community0.500000
myanmar0.500000
karen0.500000
LOWER IN hmong0.500000
LOWER IN china0.500000
saint louis0.500000
saint louis zoo0.500000
tunapuco0.500000
chuquisaca department0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
rural community0.454545
colon0.333333
forager0.333333
nepal0.333333
tibet autonomous region0.333333
LOWER IN colon0.333333
toronto0.333333
madagascar0.333333
LOWER IN central african republic0.333333
nanchang city prefecture0.333333
human middle aged stage0.333333
venezuela0.333333
amerindian0.333333
LOWER IN state of oklahoma0.333333
LOWER IN age 1 month0.333333
age 5-13 years0.333333
LOWER IN pan troglodytes troglodytes0.333333
india0.285714
belgium0.250000
age 2 months0.250000
13-year-old human stage0.250000
chimpanzee0.250000
hunter gatherer0.250000
small village0.250000
gay0.250000
bolivia0.250000
obsolete_juvenile stage0.200000
pan troglodytes0.200000
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
LOWER IN duodenum0.181818
macaca mulatta0.166667
tibetan plateau0.166667
juvenile organism0.166667
LOWER IN small intestine0.166667
thailand0.166667
egypt0.166667
peru0.166667
homosexual0.166667
msm0.166667
state of oregon0.166667
LOWER IN city0.150000
3-month-old human stage0.142857
LOWER IN finland0.142857
sus scrofa0.125000
pig0.125000
kingdom of norway0.125000
LOWER IN mouth mucosa0.111111
hiv infection0.100000
crohn's disease0.083333
child0.083333
monkey0.071429
south africa0.071429
zoological garden0.066667
sweden0.066667
LOWER IN antibiotic0.062500
LOWER IN ileum0.062500
feces0.057325
captive0.055556
homo sapiens0.055351
kingdom of spain0.047619
LOWER IN mouth0.041667
LOWER IN wild0.041667
LOWER IN state of california0.038462
adult0.034682
female0.031746
male0.030303
LOWER IN child0.027778
africa0.026316
Fraction of annotations for the query sequences containing the term
TermScore
feces0.962963
homo sapiens0.666667
united states of america0.296296
adult0.259259
research facility0.222222
rural community0.222222
child0.185185
macaca mulatta0.148148
monkey0.148148
captive0.148148
rhesus macaque0.148148
obsolete_juvenile stage0.111111
LOWER IN city0.111111
female0.111111
LOWER IN united states of america0.111111
zoological garden0.111111
sus scrofa0.074074
belgium0.074074
pig0.074074
3-month-old human stage0.074074
LOWER IN age 8 months0.074074
india0.074074
LOWER IN duodenum0.074074
africa0.074074
thailand0.074074
pan troglodytes0.074074
chimpanzee0.074074
LOWER IN wild0.074074
LOWER IN republic of congo0.074074
LOWER IN nouabale-ndoki national park0.074074
control0.037037
LOWER IN antibiotic0.037037
LOWER IN tylosin phosphate0.037037
age 2 months0.037037
colon0.037037
crohn's disease0.037037
LOWER IN control0.037037
forager0.037037
chepang0.037037
LOWER IN tharu0.037037
LOWER IN agrarian0.037037
nepal0.037037
himalayas0.037037
age 6 months0.037037
gannan tibetan autonomous prefecture0.037037
LOWER IN gangcha region0.037037
tibetan plateau0.037037
tibet autonomous region0.037037
LOWER IN colon0.037037
LOWER IN ileum0.037037
kingdom of norway0.037037
LOWER IN finland0.037037
juvenile organism0.037037
13-year-old human stage0.037037
LOWER IN small intestine0.037037
new delhi0.037037
LOWER IN child0.037037
toronto0.037037
madagascar0.037037
antananarivo0.037037
LOWER IN central african republic0.037037
LOWER IN bangui0.037037
nanchang city prefecture0.037037
china0.037037
duroc pig0.037037
age 140 days0.037037
bushbuckridge local municipality0.037037
peri-urban community0.037037
LOWER IN soweto0.037037
LOWER IN urban community0.037037
south africa0.037037
human middle aged stage0.037037
myanmar0.037037
karen0.037037
LOWER IN hmong0.037037
LOWER IN china0.037037
egypt0.037037
saint louis0.037037
saint louis zoo0.037037
venezuela0.037037
amerindian0.037037
hunter gatherer0.037037
peru0.037037
small village0.037037
tunapuco0.037037
LOWER IN state of oklahoma0.037037
gay0.037037
homosexual0.037037
msm0.037037
LOWER IN heterosexual0.037037
LOWER IN msw0.037037
hiv infection0.037037
kingdom of spain0.037037
sweden0.037037
male0.037037
state of oregon0.037037
LOWER IN state of california0.037037
LOWER IN age 1 month0.037037
LOWER IN mouth mucosa0.037037
LOWER IN mouth0.037037
Exp. ID User ID Description Date Region Flag Sequences
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in forager chepang compared to tharu agrarian in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 73
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 123
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
861amnon high in rural community bushbuckridge local municipality peri-urban community compared to city soweto urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 289
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org