Search result for sequence:
TACGGAGGGTGCGAGCGTTGTTCGGAATCACTGGGCGTAAAGGGCGCGCAGGCGGTTTGTTTAGTCAGATGTGAAAGCCCACGGCTTAACCGTGGAAGTGCATTTGAAACTGGCAGACTTGAGTACCAGAGGGGAAGGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
shore0.500000
danzhou xinyinggang nature reserve0.500000
mangrove biome0.500000
mangrove swamp0.500000
rhizophora stylosa0.500000
east china sea0.500000
dongzhaigang national nature reserve0.500000
kandelia candel0.500000
mudflat0.500000
leizhou nature reserve0.500000
futian national nature reserve0.500000
ximendao national marine reserve0.500000
hainan autonomous prefecture0.333333
spartina alterniflora0.333333
mangrove0.333333
guangdong province0.333333
hawaii0.250000
marine sediment0.214286
depth 0-20cm0.200000
zhejiang province0.200000
ocean0.062500
sediment0.043478
rhizosphere0.037037
china0.031250
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.923077
china0.923077
mangrove swamp0.846154
mangrove biome0.769231
depth 0-20cm0.769231
soil0.769231
hainan autonomous prefecture0.307692
spartina alterniflora0.307692
mangrove0.307692
zhejiang province0.307692
kandelia candel0.230769
danzhou xinyinggang nature reserve0.153846
dongzhaigang national nature reserve0.153846
mudflat0.153846
leizhou nature reserve0.153846
guangdong province0.153846
futian national nature reserve0.153846
ximendao national marine reserve0.153846
hawaii0.076923
shore0.076923
rhizophora stylosa0.076923
ocean0.076923
sediment0.076923
east china sea0.076923
rhizosphere0.076923
Exp. ID User ID Description Date Region Flag Sequences
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
571amnoncommon danzhou xinyinggang nature reserve, hainan autonomous prefecture, spartina alterniflora, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1169
571amnoncommon rhizophora stylosa, mangrove, danzhou xinyinggang nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon dongzhaigang national nature reserve, hainan autonomous prefecture, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1351
571amnoncommon mudflat, dongzhaigang national nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1422
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon kandelia candel, mangrove, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1523
571amnoncommon mudflat, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1587
571amnoncommon zhejiang province, ximendao national marine reserve, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1636
571amnoncommon spartina alterniflora, zhejiang province, ximendao national marine reserve, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1668
571amnoncommon futian national nature reserve, spartina alterniflora, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org