Search result for sequence:
TACGGAGGGTGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCTTTATAAGTCAGATGTGAAAGCCCACGGCTTAACTGTGGAAGTGCATTTGAAACTGTGAAGCTTGAGTATCGGAGGGGAGTGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
leizhou nature reserve0.500000
kandelia candel0.500000
futian national nature reserve0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
ximendao national marine reserve0.500000
nan'ao island0.500000
east china sea0.500000
yushan islands0.500000
LOWER IN other regions0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
shenzhen futian national nature reserve0.500000
guangdong province0.333333
mangrove0.333333
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
marine sediment0.214286
zhejiang province0.166667
depth 0-20cm0.142857
LOWER IN sea water0.142857
LOWER IN water0.090909
sediment0.086957
ocean0.062500
china0.038095
rhizosphere0.031250
soil0.016129
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
marine sediment0.913043
mangrove swamp0.869565
soil0.782609
depth 0-20cm0.782609
mangrove0.391304
kandelia candel0.347826
zhejiang province0.304348
guangdong province0.260870
spartina alterniflora0.217391
hainan autonomous prefecture0.217391
leizhou nature reserve0.173913
futian national nature reserve0.173913
mudflat0.173913
dongzhaigang national nature reserve0.130435
ximendao national marine reserve0.130435
sediment0.130435
rhizosphere0.086957
nan'ao island0.086957
danzhou xinyinggang nature reserve0.086957
shenzhen futian national nature reserve0.086957
LOWER IN water0.043478
LOWER IN sea water0.043478
ocean0.043478
east china sea0.043478
yushan islands0.043478
LOWER IN other regions0.043478
rhizophora stylosa0.043478
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 3
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 5
34amnonhigh freq. in mangrove rhizosphere (dominant mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 6
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org