Search result for sequence:
TACGGAGGGTGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCTTTATAAGTCAGATGTGAAATCCCACGGCTCAACTGTGGAAGTGCATTTGAAACTGTGAGGCTTGAGTATCGGAGGGGAGTGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
saline marsh0.500000
kandelia candel0.500000
futian national nature reserve0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
spartina alterniflora0.333333
low salinity0.333333
LOWER IN high salinity0.333333
mangrove swamp0.250000
zhejiang province0.166667
depth 0-20cm0.142857
atlantic ocean0.125000
marine sediment0.071429
sediment0.043478
rhizosphere0.031250
soil0.016129
china0.009524
united states of america0.005025
Fraction of annotations for the query sequences containing the term
TermScore
china0.857143
soil0.857143
mangrove swamp0.857143
marine sediment0.857143
depth 0-20cm0.857143
hainan autonomous prefecture0.714286
mangrove0.571429
dongzhaigang national nature reserve0.428571
danzhou xinyinggang nature reserve0.285714
rhizophora stylosa0.285714
mudflat0.285714
kandelia candel0.285714
rhizosphere0.142857
saline marsh0.142857
united states of america0.142857
atlantic ocean0.142857
sediment0.142857
spartina alterniflora0.142857
low salinity0.142857
LOWER IN high salinity0.142857
zhejiang province0.142857
futian national nature reserve0.142857

Problems / suggestions? Please email info AT dbbact DOT org