Search result for sequence:
TACGGGGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGACCGTTAAGTCAGGGGTGAAAAGTTCGGGCTCAACTCGAACCGTGCCTTTGATACTGGCGGACTGGAGTGTGATAGACGTGGCCGGAATGTGGAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
saint louis zoo0.500000
saint louis0.500000
lincoln park zoo0.500000
loxodonta africana0.500000
african elephant0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
gorilla gorilla gorilla0.500000
holstein-friesian bull0.500000
restricted feed0.500000
LOWER IN normal feed0.500000
chicago0.333333
pan troglodytes0.250000
chimpanzee0.250000
ireland0.250000
gorilla gorilla0.200000
state of tennessee0.200000
zoological garden0.181818
LOWER IN wild0.100000
bos taurus0.076923
rumen0.076923
diet0.041667
united states of america0.009479
feces0.008097
LOWER IN control0.006944
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.900000
zoological garden0.900000
feces0.900000
pan troglodytes0.400000
chimpanzee0.400000
saint louis zoo0.300000
saint louis0.300000
gorilla gorilla0.300000
lincoln park zoo0.300000
chicago0.300000
LOWER IN nouabale-ndoki national park0.200000
LOWER IN republic of congo0.200000
LOWER IN wild0.200000
loxodonta africana0.100000
african elephant0.100000
state of tennessee0.100000
LOWER IN pan troglodytes troglodytes0.100000
gorilla gorilla gorilla0.100000
bos taurus0.100000
rumen0.100000
holstein-friesian bull0.100000
ireland0.100000
restricted feed0.100000
diet0.100000
LOWER IN control0.100000
LOWER IN normal feed0.100000
Exp. ID User ID Description Date Region Flag Sequences
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 7
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 10
620amnondominant saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 14
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 15
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 251
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 357
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 529
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 963
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1018
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1734

Problems / suggestions? Please email info AT dbbact DOT org