Search result for sequence:
TACGGGGGATACGAGCGTTCTCCAAAATGACTGGGCGTAAAGTGTATGTAGGTGGGTTAGTATGTTCTTACTGAAAAACTATTTTATAAACTTAGAAGAAGAAAGAAAACTATTAACCTTGAGTTCGATTGGGGTAAGAGGAATTTTTTG
common ontology terms
term enrichment score
TermScore
ground beef food product0.666667
sarcocystis0.500000
foodon product type0.333333
state of colorado0.200000
united states of america0.008163
Fraction of dbbact annotations with this term covered by the query
TermScore
sarcocystis0.500000
ground beef food product0.500000
foodon product type0.200000
state of colorado0.111111
united states of america0.004098
Fraction of annotations for the query sequences containing the term
TermScore
united states of america1.000000
state of colorado1.000000
foodon product type1.000000
ground beef food product1.000000
sarcocystis0.500000

Problems / suggestions? Please email info AT dbbact DOT org