Search result for sequence:
TACGGGGGATGCAAGCGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAGTGTGTTCTTAGTTAAATTATGAAGCCTAACTTCATGAAAAGTAAGAAAACTATTAGACTTGAGTACGATAGGGGTAAGAGGAATTCTTCG
common ontology terms
term enrichment score
TermScore
coral0.567657
tissue0.500000
skeleton0.388889
ocean0.221649
porites lobata0.185185
turbinaria reniformis0.153846
pocillopora damicornis0.153846
stylophora pistillata0.153846
porites cylindrica0.153846
symphyllia0.153846
galaxea astreata0.153846
mucus0.139535
diploastrea heliopora0.120000
echinopora mammiformis0.120000
pavona varians0.083333
fungia0.083333
favites abdita0.043478
isopora palifera0.043478
physogyra lichtensteini0.043478
porites astreoides0.043478
bermuda0.043478
microbial mat0.043478
red sea0.043478
anthozoa0.043478
black band disease0.043478
LOWER IN mucus0.042553
disease0.039216
sea water0.025316
LOWER IN control0.009346
Fraction of dbbact annotations with this term covered by the query
TermScore
tissue0.500000
pavona varians0.500000
skeleton0.500000
turbinaria reniformis0.500000
porites lobata0.500000
pocillopora damicornis0.500000
diploastrea heliopora0.500000
stylophora pistillata0.500000
porites cylindrica0.500000
symphyllia0.500000
galaxea astreata0.500000
echinopora mammiformis0.500000
fungia0.500000
favites abdita0.500000
isopora palifera0.500000
physogyra lichtensteini0.500000
porites astreoides0.500000
bermuda0.500000
microbial mat0.500000
red sea0.500000
anthozoa0.500000
black band disease0.500000
coral0.400000
LOWER IN mucus0.333333
mucus0.142857
disease0.142857
ocean0.125000
sea water0.028571
LOWER IN control0.005882
Fraction of annotations for the query sequences containing the term
TermScore
ocean0.977273
coral0.977273
tissue0.500000
skeleton0.318182
mucus0.136364
porites lobata0.113636
turbinaria reniformis0.090909
pocillopora damicornis0.090909
stylophora pistillata0.090909
porites cylindrica0.090909
symphyllia0.090909
galaxea astreata0.090909
diploastrea heliopora0.068182
echinopora mammiformis0.068182
pavona varians0.045455
fungia0.045455
favites abdita0.022727
isopora palifera0.022727
physogyra lichtensteini0.022727
LOWER IN mucus0.022727
porites astreoides0.022727
LOWER IN control0.022727
sea water0.022727
bermuda0.022727
microbial mat0.022727
red sea0.022727
anthozoa0.022727
black band disease0.022727
disease0.022727
Exp. ID User ID Description Date Region Flag Sequences
418amnondominant ocean, tissue, coral, pavona varians2018-12-02v4No1 / 3
418amnondominant ocean, skeleton, coral, turbinaria reniformis2018-12-02v4No1 / 3
418amnondominant ocean, tissue, coral, porites lobata2018-12-02v4No1 / 5
418amnondominant ocean, tissue, coral, turbinaria reniformis2018-12-02v4No1 / 5
418amnondominant ocean, tissue, coral, pocillopora damicornis2018-12-02v4No1 / 6
418amnondominant ocean, skeleton, coral, porites lobata2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, diploastrea heliopora2018-12-02v4No1 / 6
418amnoncommon ocean, skeleton, coral, turbinaria reniformis2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, stylophora pistillata2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 6
418amnoncommon ocean, mucus, coral, porites lobata2018-12-02v4No1 / 7
418amnoncommon ocean, tissue, coral, symphyllia2018-12-02v4No1 / 7
418amnondominant ocean, skeleton, coral, galaxea astreata2018-12-02v4No1 / 8
418amnoncommon ocean, skeleton, coral, porites lobata2018-12-02v4No1 / 8
418amnondominant ocean, tissue, coral, symphyllia2018-12-02v4No1 / 8
418amnondominant ocean, skeleton, coral, stylophora pistillata2018-12-02v4No1 / 8
418amnondominant ocean, tissue, coral, galaxea astreata2018-12-02v4No1 / 9
418amnondominant ocean, skeleton, coral, pocillopora damicornis2018-12-02v4No1 / 9
418amnoncommon ocean, tissue, coral, porites lobata2018-12-02v4No1 / 9
418amnoncommon ocean, tissue, coral, echinopora mammiformis2018-12-02v4No1 / 9
418amnondominant ocean, tissue, coral, fungia2018-12-02v4No1 / 9
418amnondominant ocean, tissue, coral, echinopora mammiformis2018-12-02v4No1 / 10
418amnoncommon ocean, tissue, coral, diploastrea heliopora2018-12-02v4No1 / 12
418amnoncommon ocean, skeleton, coral, symphyllia2018-12-02v4No1 / 13
418amnoncommon ocean, tissue, coral, pocillopora damicornis2018-12-02v4No1 / 14
418amnoncommon ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 14
418amnoncommon ocean, tissue, coral, turbinaria reniformis2018-12-02v4No1 / 16
418amnoncommon ocean, tissue, coral, stylophora pistillata2018-12-02v4No1 / 16
418amnoncommon ocean, skeleton, coral, favites abdita2018-12-02v4No1 / 18
418amnoncommon ocean, mucus, coral, isopora palifera2018-12-02v4No1 / 18
418amnoncommon ocean, skeleton, coral, pocillopora damicornis2018-12-02v4No1 / 19
418amnoncommon ocean, skeleton, coral, porites cylindrica2018-12-02v4No1 / 20
418amnoncommon ocean, skeleton, coral, stylophora pistillata2018-12-02v4No1 / 21
418amnoncommon ocean, mucus, coral, porites cylindrica2018-12-02v4No1 / 21
418amnoncommon ocean, mucus, coral, physogyra lichtensteini2018-12-02v4No1 / 25
418amnoncommon ocean, tissue, coral, fungia2018-12-02v4No1 / 28
418amnoncommon ocean, mucus, coral, echinopora mammiformis2018-12-02v4No1 / 34
418amnoncommon ocean, mucus, coral, symphyllia2018-12-02v4No1 / 38
418amnoncommon ocean, skeleton, coral, pavona varians2018-12-02v4No1 / 42
418amnoncommon ocean, skeleton, coral, galaxea astreata2018-12-02v4No1 / 42
418amnoncommon ocean, tissue, coral, galaxea astreata2018-12-02v4No1 / 44
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-02v4No1 / 44
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v4No1 / 61
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 119

Problems / suggestions? Please email info AT dbbact DOT org