Search result for sequence:
TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAAGTGCAAGTCAGCGGTGAAATCCCCGCGCTCAACGCGGGAGTTGCCGTTGATACTGTACATCTGGAATGCTCTTGCCGTGGGAGGAATGAGTAG
common ontology terms
term enrichment score
TermScore
pig0.448980
sus scrofa0.421053
china0.361290
macaca mulatta0.292135
rhesus macaque0.222222
zoological garden0.215054
monkey0.201681
rural community0.178571
feces0.159303
caecum0.130719
farm0.118519
child0.111111
homo sapiens0.092736
hunter gatherer0.089552
ascending colon0.086957
province of alberta0.086957
cayo santiago0.086957
puerto rico0.086957
indian rhesus macaque0.086957
chuquisaca department0.086957
age 5-13 years0.083333
captive0.080000
bolivia0.080000
female organism0.078947
age 6 weeks0.076923
jiangxi province0.074074
LOWER IN city0.072289
3-month-old human stage0.071429
ileum0.068966
male organism0.066667
LOWER IN wild0.060606
age 1 month0.060606
venezuela0.060606
amerindian0.060606
research facility0.059993
age 6 months0.059701
LOWER IN age 8 months0.059701
age 12-19 weeks0.059701
duroc pig0.059701
age 140 days0.059701
weaned0.059701
corn and soybean diet0.059701
age 4-7 weeks0.059701
mongolian sheep0.059701
LOWER IN republic of congo0.059701
LOWER IN nouabale-ndoki national park0.059701
united states of america0.059041
tibet autonomous region0.057971
gorilla gorilla0.057971
nanchang city prefecture0.057971
papio anubis0.057971
colon0.057971
belgium0.056338
adult organism0.056338
chimpanzee0.056338
left colon0.056338
rectal swab0.054795
state of tennessee0.054795
pan troglodytes0.054795
right colon0.054795
adult0.054484
cecal content0.053333
tonsil0.051948
united kingdom0.051613
LOWER IN ileum0.050633
state of michigan0.049383
LOWER IN mouth mucosa0.049383
obsolete_juvenile stage0.048193
rectum0.047059
ovis aries0.045977
infant0.044944
canada0.043478
female0.042328
male0.037037
LOWER IN mouth0.036036
schistosomiasis0.031250
urinary schistosomiasis0.031250
chepang0.030769
LOWER IN tharu0.030769
LOWER IN agrarian0.030769
himalayas0.030769
salmonella enterica subsp. enterica serovar typhimurium0.030769
salmonellosis0.030769
LOWER IN tibetan pig0.030769
LOWER IN tibetan swine0.030769
kebbi state0.030769
hadza0.030769
age > 1 year0.030769
suckling0.030769
preweaned0.030769
age 2-4 weeks0.030769
ngoantet0.030769
LOWER IN yaounde0.030769
pithecia pithecia0.030769
white-faced saki0.030769
como zoo0.030769
sus scrofa domesticus0.030769
LOWER IN age 6-10 weeks0.030769
antananarivo0.030769
LOWER IN bangui0.030769
Fraction of dbbact annotations with this term covered by the query
TermScore
china3.500000
schistosomiasis1.000000
urinary schistosomiasis1.000000
hunter gatherer0.750000
pig0.687500
age 1 month0.666667
venezuela0.666667
amerindian0.666667
sus scrofa0.625000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
himalayas0.500000
age 6 months0.500000
LOWER IN age 8 months0.500000
macaca mulatta0.500000
rhesus macaque0.500000
ascending colon0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
province of alberta0.500000
age 12-19 weeks0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
kebbi state0.500000
hadza0.500000
age > 1 year0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
ngoantet0.500000
LOWER IN yaounde0.500000
pithecia pithecia0.500000
white-faced saki0.500000
como zoo0.500000
sus scrofa domesticus0.500000
LOWER IN age 6-10 weeks0.500000
duroc pig0.500000
age 140 days0.500000
antananarivo0.500000
LOWER IN bangui0.500000
age 8 months0.500000
LOWER IN diarrhea0.500000
bangladesh0.500000
weaned0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
mongolian sheep0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
zambia0.500000
first pregnancy0.500000
LOWER IN multiple pregnancies0.500000
lincoln park zoo0.500000
age 10-15 years0.500000
saint louis0.500000
saint louis zoo0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
tunapuco0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN forearm0.500000
chuquisaca department0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
rural community0.454545
forager0.333333
nepal0.333333
tibet autonomous region0.333333
10-15-years-old human0.333333
cameroon0.333333
zoological garden0.333333
gorilla gorilla0.333333
nanchang city prefecture0.333333
madagascar0.333333
LOWER IN central african republic0.333333
age < 1 year0.333333
papio anubis0.333333
olive baboon0.333333
colon0.333333
heavy metal0.333333
papio0.333333
baboon0.333333
chicago0.333333
macaque0.333333
LOWER IN state of oklahoma0.333333
ninth decade human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
LOWER IN arm0.333333
age 5-13 years0.333333
LOWER IN age 1 month0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.746032
united states of america0.333333
pig0.333333
sus scrofa0.317460
homo sapiens0.285714
research facility0.253968
macaca mulatta0.206349
monkey0.190476
china0.190476
caecum0.158730
zoological garden0.158730
captive0.142857
rhesus macaque0.142857
adult0.126984
farm0.126984
rural community0.111111
child0.111111
united kingdom0.063492
female0.063492
3-month-old human stage0.047619
male0.047619
canada0.047619
age 6 weeks0.047619
ascending colon0.047619
male organism0.047619
province of alberta0.047619
control0.047619
hunter gatherer0.047619
female organism0.047619
cayo santiago0.047619
puerto rico0.047619
indian rhesus macaque0.047619
jiangxi province0.047619
LOWER IN city0.047619
ileum0.047619
LOWER IN wild0.047619
bolivia0.047619
chuquisaca department0.047619
age 5-13 years0.047619
belgium0.031746
age 6 months0.031746
LOWER IN age 8 months0.031746
age 1 month0.031746
tonsil0.031746
state of michigan0.031746
age 12-19 weeks0.031746
infant0.031746
tibet autonomous region0.031746
cecal content0.031746
LOWER IN ileum0.031746
gorilla gorilla0.031746
nanchang city prefecture0.031746
duroc pig0.031746
age 140 days0.031746
rectal swab0.031746
weaned0.031746
corn and soybean diet0.031746
age 4-7 weeks0.031746
papio anubis0.031746
state of tennessee0.031746
rectum0.031746
colon0.031746
ovis aries0.031746
mongolian sheep0.031746
obsolete_juvenile stage0.031746
adult organism0.031746
pan troglodytes0.031746
chimpanzee0.031746
venezuela0.031746
amerindian0.031746
LOWER IN united states of america0.031746
left colon0.031746
right colon0.031746
LOWER IN mouth mucosa0.031746
LOWER IN mouth0.031746
LOWER IN republic of congo0.031746
LOWER IN nouabale-ndoki national park0.031746
crohn's disease0.015873
LOWER IN control0.015873
forager0.015873
chepang0.015873
LOWER IN tharu0.015873
LOWER IN agrarian0.015873
nepal0.015873
himalayas0.015873
salmonella enterica subsp. enterica serovar typhimurium0.015873
salmonellosis0.015873
intestinal contents0.015873
LOWER IN mucosa0.015873
age0.015873
age 1 week0.015873
1-month-old human stage0.015873
LOWER IN 1-month-old human stage0.015873
kingdom of denmark0.015873
LOWER IN tibetan pig0.015873
LOWER IN tibetan swine0.015873
nigeria0.015873
kebbi state0.015873
schistosomiasis0.015873
urinary schistosomiasis0.015873
Exp. ID User ID Description Date Region Flag Sequences
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in forager chepang compared to tharu agrarian in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 73
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
673amnoncommon research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 99
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
111amnoncommon rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 330
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org