Search result for sequence:
TACGGGGGGAGCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTGCGCAGGCGGGAGGATAGGTCGAATGTGAAAACCCCGGGCTCAACCCGGGGCCTGCATCCGAAACCATTCTTCTTGAGTATCGGAGAGGGAAGCGGAACTCCAGG
common ontology terms
term enrichment score
TermScore
dongzhaigang national nature reserve0.666667
mudflat0.666667
hainan autonomous prefecture0.500000
mangrove swamp0.400000
depth 0-20cm0.250000
marine sediment0.133333
soil0.031250
china0.018692
Fraction of dbbact annotations with this term covered by the query
TermScore
dongzhaigang national nature reserve0.500000
mudflat0.500000
hainan autonomous prefecture0.333333
mangrove swamp0.250000
depth 0-20cm0.142857
marine sediment0.071429
soil0.015873
china0.009434
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
soil1.000000
mangrove swamp1.000000
marine sediment1.000000
depth 0-20cm1.000000
hainan autonomous prefecture1.000000
dongzhaigang national nature reserve1.000000
mudflat1.000000

Problems / suggestions? Please email info AT dbbact DOT org