Search result for sequence:
TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCCACCGCAAGTCGACTGTGAAATCTCCGGGCTTAACCCGGAAAGGTCAGCCGATACTGCGGGGCTAGAGTGCAGAAGGGGCAACTGGAATTCTCG
common ontology terms
term enrichment score
TermScore
soil0.558984
rhizosphere0.318182
china0.268232
cultivated environment0.225806
kalamazoo loam0.156250
mesic type hapludalf0.156250
kellogg biological station0.156250
zea mays0.145570
silt loam0.145570
depth 0-20cm0.136307
loess plateau0.133333
shaanxi province0.123377
glycine max0.113428
triticum aestivum0.112894
citrus0.108844
reforestation0.105960
robinia pseudoacacia0.105960
state of michigan0.101010
ph 7-80.100000
agricultural field0.098160
agricultural feature0.096998
depth 0-10cm0.094118
restored prairie0.093960
mexico0.093023
united states of america0.092715
united states0.087838
des moines0.087838
nicollet soil series0.087838
iowa0.084142
grazing exclusion0.081633
haplic calcisol0.081633
calci-orthic aridisol0.081633
ningxia province0.081633
yunwushan national natural grassland protection zone0.081633
farm0.075181
ph 6-70.074408
oryza sativa0.074408
tree0.073950
orchard0.072607
clay loam0.070175
wheat0.068966
jiangsu province0.067416
panicum virgatum0.062500
desert0.061453
state of california0.061453
depth 10-25cm0.060606
leaf0.058824
topsoil0.057971
heilongjiang province0.056738
ph 60.055944
guanajuato0.055944
corn0.054422
root0.053333
state of new york0.051613
miscanthus0.049296
myrtillocactus geometrizans0.049296
opuntia robusta0.049296
limestone0.049296
fungicide0.049296
tobacco field0.049296
difenoconazole0.049296
agave0.049296
songnen plain0.049296
da'an station0.049296
salic solonetz0.049296
low sodicity0.049296
hunan province0.048894
depth 0-15cm0.048110
cactus0.048110
semi-arid0.048110
low salinity0.046980
state of tennessee0.045902
kelley0.042553
subsurface drainage0.042553
continuous corn0.042553
temperate0.042553
taxus0.042553
gleysol0.042553
sihong county0.042553
poplar0.042553
poplar plantation0.042553
chenwei forest0.042553
nanjing county0.042553
chrysanthemum0.042553
chrysanthemum morifolium ramat.0.042553
depth 0-40cm0.042553
20 years0.042553
north china plain0.042553
bulk soil0.042254
ph 70.042105
biochar0.041958
northeast china0.041667
ph 6.90.041667
paddy field soil0.041667
depth 25-50cm0.041667
state of florida0.038095
ph 5.90.036036
ph 6-6.50.035714
27-35 years of grazing exclusion0.035714
populus0.035714
Fraction of dbbact annotations with this term covered by the query
TermScore
cultivated environment0.875000
agricultural feature0.750000
npk fertilizer0.750000
ph 5.90.666667
citrus0.666667
heilongjiang province0.666667
pasture0.666667
LOWER IN depth 20-40cm0.666667
clay loam0.666667
low fusarium cumulative disease incidence 0.666667
ph 7.70.666667
chemical fertilization n,p,k0.666667
ph 7.50.666667
loess plateau0.666667
hordeum vulgare0.666667
soybean0.666667
trichoderma guizhouense njau 47420.666667
depth 10-20cm0.666667
depth 5cm0.600000
glycine max0.571429
triticum aestivum0.545455
red soil0.500000
zea mays0.500000
united states0.500000
des moines0.500000
nicollet soil series0.500000
kelley0.500000
ph 6.20.500000
subsurface drainage0.500000
continuous corn0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
miscanthus0.500000
restored prairie0.500000
rhizosphere0.500000
temperate0.500000
taxus0.500000
taxus cuspidata0.500000
panicum virgatum0.500000
quarry0.500000
greenschist0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
guanajuato0.500000
taxus media0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
citrullus lanatus0.500000
co culture with wheat (triticum aestivum l.)0.500000
inoculated with fusarium oxysporum f. sp. niveum0.500000
grassland0.500000
steppe0.500000
ph 7-80.500000
limestone0.500000
fungicide0.500000
tobacco field0.500000
difenoconazole0.500000
tobacco plant present0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
hypopharynx0.500000
agave0.500000
agave tequiliana0.500000
greenhouse0.500000
malvaviscus penduliflorus0.500000
external ear0.500000
presence of tobacco plants0.500000
LOWER IN absence of tobacco plants0.500000
LOWER IN un-inoculated0.500000
seed structure0.500000
arachis hypogaea0.500000
peanut0.500000
maryland county0.500000
27-35 years of grazing exclusion0.500000
LOWER IN 0-9 years of grazing exclusion0.500000
grazing exclusion0.500000
haplic calcisol0.500000
calci-orthic aridisol0.500000
ningxia province0.500000
yunwushan national natural grassland protection zone0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
LOWER IN barn0.500000
gleysol0.500000
sihong county0.500000
poplar0.500000
poplar plantation0.500000
chenwei forest0.500000
conventional tillage0.500000
deep plough0.500000
compost biofilter0.500000
pig manure0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.733333
china0.481481
united states of america0.233333
rhizosphere0.233333
cultivated environment0.129630
state of michigan0.092593
kalamazoo loam0.092593
mesic type hapludalf0.092593
kellogg biological station0.092593
zea mays0.085185
silt loam0.085185
depth 0-20cm0.081481
loess plateau0.074074
shaanxi province0.070370
triticum aestivum0.062963
glycine max0.062963
agricultural field0.059259
citrus0.059259
reforestation0.059259
robinia pseudoacacia0.059259
depth 0-10cm0.055556
mexico0.055556
ph 7-80.055556
restored prairie0.051852
agricultural feature0.051852
iowa0.048148
united states0.048148
des moines0.048148
nicollet soil series0.048148
farm0.048148
grazing exclusion0.044444
haplic calcisol0.044444
calci-orthic aridisol0.044444
ningxia province0.044444
yunwushan national natural grassland protection zone0.044444
tree0.040741
orchard0.040741
desert0.040741
state of california0.040741
ph 6-70.040741
oryza sativa0.040741
jiangsu province0.037037
clay loam0.037037
wheat0.037037
depth 10-25cm0.033333
panicum virgatum0.033333
leaf0.033333
topsoil0.033333
corn0.029630
heilongjiang province0.029630
ph 60.029630
guanajuato0.029630
root0.029630
state of new york0.029630
hunan province0.025926
depth 0-15cm0.025926
miscanthus0.025926
myrtillocactus geometrizans0.025926
opuntia robusta0.025926
cactus0.025926
semi-arid0.025926
limestone0.025926
fungicide0.025926
tobacco field0.025926
difenoconazole0.025926
agave0.025926
state of tennessee0.025926
low salinity0.025926
songnen plain0.025926
da'an station0.025926
salic solonetz0.025926
low sodicity0.025926
kelley0.022222
subsurface drainage0.022222
continuous corn0.022222
temperate0.022222
taxus0.022222
northeast china0.022222
ph 70.022222
biochar0.022222
gleysol0.022222
sihong county0.022222
poplar0.022222
poplar plantation0.022222
chenwei forest0.022222
nanjing county0.022222
chrysanthemum0.022222
chrysanthemum morifolium ramat.0.022222
ph 6.90.022222
state of florida0.022222
paddy field soil0.022222
depth 25-50cm0.022222
depth 0-40cm0.022222
bulk soil0.022222
20 years0.022222
winter0.022222
north china plain0.022222
ph 5.90.018519
depth 50-100m0.018519
solanum lycopersicum0.018519
Exp. ID User ID Description Date Region Flag Sequences
412amnondominant soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 1
801sheryoDominant at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 3
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 3
821sheryoDominant in soil of miscanthus field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 3
134amnondominant rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 4
415amnondominant orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 4
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 0-10cm, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 4
205amnonhigh freq. in Ely Greenstone rock piles (dominant united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 5
414amnondominant agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 5
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 5
146amnondominant united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 6
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 6
134amnondominant rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 8
415amnondominant orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 8
415amnondominant orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 8
129amnondominant soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 9
129amnondominant soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil inucolated with Fusarium oxysporum f. sp. niveum (dominant rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 9
279amnondominant grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 11
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
582amnoncommon united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 30
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
361amnoncommon leaf, austria, plant, greenhouse, malvaviscus penduliflorus2018-08-21v4No1 / 102
582amnoncommon united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 124
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 131
675sheryoHigher in watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum compared to uninoculated watermelon rhizosphere soil ( high in inoculated with fusarium oxysporum f. sp. niveum compared to un-inoculated in rhizosphere ph 7 citrullus lanatus china co culture with wheat (triticum aestivum l.) )2028-02-22v4No1 / 136
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
129amnon high in soil compared to rhizosphere in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 221
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 280
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 299
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 0-20cm compared to depth 20-40cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 312
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
767sheryoHigh in conventional tillage compared to conservation tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conventional tillage deep plough compared to conservation tillage in soil compost biofilter pig manure compost soil paenibacillus china nanjing county chrysanthemum bio-organic fertilizer chrysanthemum morifolium ramat. ph 6.9 paenibacillus polymyxa soil fumigation dazomet )2021-04-18v4No1 / 355
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in pig manure compost soil paenibacillus low fusarium cumulative disease incidence bio-organic fertilizer conventional tillage paenibacillus polymyxa soil fumigation dazomet deep plough compared to control high fusarium cumulative disease incidence in soil china nanjing county chrysanthemum chrysanthemum morifolium ramat. ph 6.9 )2021-04-18v4No1 / 360
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
360amnoncommon desert, soil, rhizosphere, state of california, agave, agave deserti2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil fertilized soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 497
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays iowa agricultural field united states des moines nicollet soil series kanawha )2021-06-15v4No1 / 501
98amnoncommon rhizosphere, state of florida, citrus, immokalee, fl, root2017-04-01v4No1 / 543
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
357amnoncommon soil, mediterranean forest biome, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 564
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth 15-30cm, kanawha)2021-06-15v4No1 / 598
415amnoncommon orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 600
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
357amnoncommon savanna, soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 614
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 7.9, nicollet soil series, depth 60-90cm, kelley, subsurface drainage)2021-06-16v4No1 / 667
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
357amnoncommon in temperate deciduous forests around the world (common soil, temperate woodland biome, topsoil, depth 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
134amnon high in temperate taxus media taxus cuspidata northeast china compared to subtropical taxus mairei southeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 734
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 747
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth 0cm compared to depth (soil) 80cm in soil low salinity china songnen plain da'an station salic solonetz low sodicity ph 9 )2021-06-08v4No1 / 748
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-15v4No1 / 760
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
615amnoncommon brazil, endosphere, greenhouse, root, campinas, saccharum, sugarcane2020-04-27v4No1 / 776
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth 25-50cm compared to depth 50-100m in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 784
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth 0-10cm compared to depth 10-20cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 807
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 811
480amnoncommon farm, pasture, soil, ireland2019-02-05v4No1 / 816
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 831
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, conventional tillage, northen israel)2021-04-18v4No1 / 861
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
769sheryocommon in no tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, northen israel, no tillage)2021-04-18v4No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in low salinity low sodicity ph 9 compared to high salinity high sodicity ph 10 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 895
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in low salinity low sodicity ph 8.5 compared to high salinity high sodicity ph 10.5 in soil depth 0cm china songnen plain da'an station salic solonetz )2021-06-08v4No1 / 932
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
98amnoncommon rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 993
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
412amnon high in ph>5 compared to ph<5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 1005
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1025
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5)2021-06-07v4No1 / 1035
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
263amnoncommon in desert soil irrigated daily in lab (common research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 1076
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 1087
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states ames des moines nicollet soil series )2021-06-15v4No1 / 1102
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 1128
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1136
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 1155
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1192
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 100-300cm)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 1274
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
309amnoncommon rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 1296
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 1326
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 1369
98amnoncommon rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
414amnon high in ph>6 compared to ph<6 npk fertilizer in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 1451
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 1506
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 1612
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
462amnon high in depth 0-30cm silt loam compared to silt clay loam detph 30-75cm in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 10-25cm compared to depth 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1704
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in soil triticum aestivum wheat china )2017-07-02v4No1 / 2933
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org