Search result for sequence:
TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGCAGGCGGTTTCGTCAGTCATGGGTGAAAGCCCCGGGCTCAACCCGGGAATGGCCTGTGAAACCACGGAACTGGAGTGCTGGAGAGGGAAGCGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
mangrove swamp0.540541
mangrove biome0.514286
marine sediment0.498221
bodega bay0.320000
depth 0-20cm0.290323
spartina alterniflora0.275862
mangrove0.275862
kandelia candel0.260870
futian national nature reserve0.260870
ocean0.244898
zhejiang province0.238095
zostera marina0.230769
marine eelgrass0.230769
sediment0.218579
danzhou xinyinggang nature reserve0.190476
leizhou nature reserve0.190476
ximendao national marine reserve0.190476
hainan autonomous prefecture0.173913
guangdong province0.173913
nan'ao island0.105263
rhizophora stylosa0.105263
east china sea0.105263
mudflat0.105263
LOWER IN leaf0.086957
state of california0.086022
LOWER IN sea water0.083333
china0.078689
LOWER IN root0.076923
LOWER IN water0.071429
root0.066667
pacific ocean0.058824
rhizosphere0.045455
sea water0.043478
soil0.035785
water0.030303
Fraction of dbbact annotations with this term covered by the query
TermScore
nan'ao island0.500000
bodega bay0.500000
danzhou xinyinggang nature reserve0.500000
mangrove biome0.500000
mangrove swamp0.500000
rhizophora stylosa0.500000
east china sea0.500000
kandelia candel0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
mudflat0.500000
ximendao national marine reserve0.500000
marine sediment0.357143
zostera marina0.333333
marine eelgrass0.333333
hainan autonomous prefecture0.333333
spartina alterniflora0.333333
mangrove0.333333
guangdong province0.333333
depth 0-20cm0.200000
zhejiang province0.200000
ocean0.187500
sediment0.173913
LOWER IN leaf0.166667
LOWER IN sea water0.142857
LOWER IN root0.111111
LOWER IN water0.090909
root0.076923
pacific ocean0.058824
state of california0.052632
china0.041667
rhizosphere0.037037
sea water0.034483
water0.020408
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.823529
china0.705882
mangrove swamp0.588235
mangrove biome0.529412
depth 0-20cm0.529412
soil0.529412
ocean0.352941
sediment0.294118
zhejiang province0.294118
state of california0.235294
bodega bay0.235294
spartina alterniflora0.235294
mangrove0.235294
zostera marina0.176471
marine eelgrass0.176471
kandelia candel0.176471
futian national nature reserve0.176471
danzhou xinyinggang nature reserve0.117647
hainan autonomous prefecture0.117647
leizhou nature reserve0.117647
guangdong province0.117647
ximendao national marine reserve0.117647
nan'ao island0.058824
LOWER IN water0.058824
LOWER IN sea water0.058824
LOWER IN leaf0.058824
root0.058824
pacific ocean0.058824
water0.058824
sea water0.058824
rhizophora stylosa0.058824
east china sea0.058824
rhizosphere0.058824
mudflat0.058824
LOWER IN root0.058824
Exp. ID User ID Description Date Region Flag Sequences
235amnoncommon in sediment near eelgrass in northern hemisphere (common sediment, marine sediment, ocean)2017-11-07v4No1 / 258
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
236amnon high in root compared to leaf in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 819
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
571amnoncommon danzhou xinyinggang nature reserve, hainan autonomous prefecture, spartina alterniflora, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1169
571amnoncommon rhizophora stylosa, mangrove, danzhou xinyinggang nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon kandelia candel, mangrove, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1435
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon kandelia candel, mangrove, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1523
571amnoncommon mudflat, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1587
571amnoncommon zhejiang province, ximendao national marine reserve, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1636
571amnoncommon spartina alterniflora, zhejiang province, ximendao national marine reserve, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1668
571amnoncommon futian national nature reserve, spartina alterniflora, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1747
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745

Problems / suggestions? Please email info AT dbbact DOT org