Search result for sequence:
TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTCGGAAGTCATGGGTGAAAGCCCCGAGCTCAACTCGGGAATGGCCTGTGAAACCACGGGGCTGGAGTGCTGGAGAGGGAAGCGGAATTCCCAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
saline marsh0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
spartina alterniflora0.333333
low salinity0.333333
LOWER IN high salinity0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
mangrove swamp0.250000
zhejiang province0.166667
depth 0-20cm0.142857
atlantic ocean0.125000
marine sediment0.071429
sediment0.043478
rhizosphere0.030303
soil0.015873
china0.009434
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
china0.714286
soil0.714286
mangrove swamp0.714286
marine sediment0.714286
depth 0-20cm0.714286
mangrove0.571429
hainan autonomous prefecture0.428571
kandelia candel0.428571
rhizosphere0.285714
saline marsh0.285714
united states of america0.285714
atlantic ocean0.285714
sediment0.285714
spartina alterniflora0.285714
dongzhaigang national nature reserve0.285714
low salinity0.142857
LOWER IN high salinity0.142857
danzhou xinyinggang nature reserve0.142857
rhizophora stylosa0.142857
mudflat0.142857
zhejiang province0.142857
futian national nature reserve0.142857
guangdong province0.142857
leizhou nature reserve0.142857

Problems / suggestions? Please email info AT dbbact DOT org