Search result for sequence:
TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCTCGTAGGCGGCCAACTAAGTCATACGTGAAATCCCTCGGCTTAACCGGGGAACTGCGTCTGATACTGGATGGCTTGAGTTCGGGAGAGGGATGCGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
rhizosphere0.377650
soil0.333262
cultivated environment0.220493
china0.173737
oryza sativa0.154839
river0.137500
ph 60.136054
farm0.126050
fresh water0.120603
mississippi river0.116223
root0.111001
united states of america0.103292
triticum aestivum0.102345
paddy field soil0.101818
cannabis sativa0.099291
hunan province0.097674
canada0.097166
citrus0.096886
lake sediment0.096886
state of california0.088398
heilongjiang province0.088235
sediment0.088203
coarse-loamy soil0.086331
depth (soil) 0-5cm0.082759
state of new york0.081159
brazil0.080107
tree0.076433
day 820.072993
kellogg biological station0.072993
mesic type hapludalf0.072993
kalamazoo loam0.072993
taihu lake0.072993
taihu national park0.072993
depth (soil) 0-10cm0.072289
glycine max0.072115
wheat0.071685
LOWER IN root0.070423
orchard0.068027
aquatic biome0.065789
zea mays0.065789
ph 7-80.063025
particles0.060150
pasture0.060150
ph 5.90.060150
populus0.059259
depth (soil) 0-20cm0.057416
state of michigan0.056497
depth (water) 20-100cm0.056497
state of tennessee0.054422
agricultural feature0.051613
water0.045732
soybean0.045627
downstream0.045113
LOWER IN upstream0.045113
tomato0.045113
jiulong river0.045113
guanajuato0.045113
red soil0.045113
manured soil0.045113
qiyang county0.045113
quaternary red clay0.045113
restored prairie0.045113
depth 5cm0.044610
wastewater treatment plant0.044118
fujian province0.044118
cambisol0.044118
depth (sediment) 0-20cm0.044118
rice0.043165
depth (soil) 50cm0.043165
biochar0.043165
jiangsu province0.040956
solanum lycopersicum0.040541
germany0.039886
spring0.039735
desert0.039735
mexico0.038961
ph 6-70.038585
leaf0.037855
equus caballus0.037500
horse0.037500
nasal cavity0.037500
pair of nares0.035503
maryland county0.030534
taxus0.030534
taxus mairei0.030534
slit loam soil0.030534
north china plain0.030534
onobrychis viciifolia0.030534
common sainfoin0.030534
LOWER IN non-manured soil0.030534
npk fertilizer0.030534
quesnel lake0.030534
minas gerais state0.030534
campos rupestres0.030534
barbacenia macrantha0.030534
root endosphere0.030534
pre-vegetative stage0.030534
early flowering stage0.030534
days 30-400.030534
ryegrass0.030534
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-nĂșcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
mississippi river0.750000
particles0.666667
soybean0.666667
pasture0.666667
heilongjiang province0.666667
paddy field soil0.666667
ph 5.90.666667
cultivated environment0.625000
maryland county0.500000
field soil0.500000
vero beach, fl0.500000
quincy, fl0.500000
central park0.500000
merlot0.500000
grapevine0.500000
downstream0.500000
LOWER IN upstream0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
unionidae0.500000
denali national park and preserve0.500000
terminus of glacier0.500000
LOWER IN top of glacier0.500000
jiulong river0.500000
arachis hypogaea0.500000
peanut0.500000
negev desert0.500000
LOWER IN heat stressed soil0.500000
boechera stricta0.500000
north china plain0.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
LOWER IN other plants0.500000
LOWER IN woundwort0.500000
LOWER IN prunella vulgaris0.500000
other plants0.500000
festuca rubra0.500000
red fescue grass0.500000
geranium pratense0.500000
meadow geranium0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
savanna0.500000
guanajuato0.500000
agave0.500000
LOWER IN barn0.500000
mine tailing0.500000
alkaline mine tailing0.500000
zone 2,30.500000
LOWER IN zone 10.500000
red soil0.500000
manured soil0.500000
LOWER IN non-manured soil0.500000
npk fertilizer0.500000
reunion island0.500000
yellow brown soil0.500000
populus0.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
shrimp farm0.500000
quesnel lake0.500000
contaminated sediment0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
root endosphere0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
stover ammendment soil0.500000
day 10.500000
LOWER IN day 120.500000
stover amended soil0.500000
campinas0.500000
pre-vegetative stage0.500000
cannabis sativa0.500000
early flowering stage0.500000
late flowering stage0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.472441
china0.370079
rhizosphere0.354331
united states of america0.314961
cultivated environment0.133858
farm0.118110
fresh water0.094488
oryza sativa0.094488
canada0.094488
river0.086614
ph 60.078740
root0.062992
mississippi river0.062992
triticum aestivum0.062992
sediment0.062992
state of california0.062992
citrus0.055118
state of new york0.055118
germany0.055118
hunan province0.055118
paddy field soil0.055118
lake sediment0.055118
cannabis sativa0.055118
tree0.047244
depth (soil) 0-20cm0.047244
depth (soil) 0-10cm0.047244
heilongjiang province0.047244
brazil0.047244
depth (soil) 0-5cm0.047244
coarse-loamy soil0.047244
LOWER IN root0.039370
aquatic biome0.039370
wheat0.039370
water0.039370
ph 7-80.039370
glycine max0.039370
zea mays0.039370
orchard0.039370
day 820.039370
state of michigan0.039370
kellogg biological station0.039370
mesic type hapludalf0.039370
kalamazoo loam0.039370
taihu lake0.039370
taihu national park0.039370
depth (water) 20-100cm0.039370
particles0.031496
agricultural feature0.031496
pasture0.031496
state of tennessee0.031496
populus0.031496
ph 5.90.031496
leaf0.023622
control0.023622
downstream0.023622
LOWER IN upstream0.023622
solanum lycopersicum0.023622
tomato0.023622
spring0.023622
wastewater treatment plant0.023622
depth 5cm0.023622
rice0.023622
depth (soil) 50cm0.023622
jiulong river0.023622
fujian province0.023622
soybean0.023622
desert0.023622
mexico0.023622
guanajuato0.023622
equus caballus0.023622
horse0.023622
nasal cavity0.023622
pair of nares0.023622
red soil0.023622
cambisol0.023622
manured soil0.023622
jiangsu province0.023622
ph 6-70.023622
biochar0.023622
qiyang county0.023622
quaternary red clay0.023622
restored prairie0.023622
depth (sediment) 0-20cm0.023622
maryland county0.015748
state of florida0.015748
LOWER IN free floating0.015748
free floating0.015748
taxus0.015748
taxus mairei0.015748
slit loam soil0.015748
LOWER IN rhizosphere0.015748
effluent0.015748
autumn0.015748
freshwater biome0.015748
upper mississippi river0.015748
research facility0.015748
state of idaho0.015748
LOWER IN leaf0.015748
north china plain0.015748
winter0.015748
Exp. ID User ID Description Date Region Flag Sequences
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
414amnon high in manured soil compared to non-manured soil in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 118
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
618amnon high in cbd shark cannabis plant compared to hash cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 197
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 252
907amnoncommon state of minnesota, bioreactor, wastewater treatment plant, united states of america2022-05-19v4No1 / 279
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in alaska united states of america denali national park and preserve glacier surface debris )2017-07-27v4No1 / 310
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
402amnon high in zone 2,3 compared to zone 1 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 322
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-nĂșcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to upstream city populated place in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 468
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
309amnon high in other plants compared to woundwort prunella vulgaris in rhizosphere germany 2018-04-05v4No1 / 550
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 573
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
103amnon high in downstream compared to upstream in river united states of america mississippi river fresh water aquatic biome free floating 2017-04-05v4No1 / 703
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond water fresh water fishpond compared to fish ictalurus punctatus channel catfish intestine in united states of america state of alabama research facility )2019-02-12v4No1 / 741
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
103amnoncommon particles, river, united states of america, mississippi river, fresh water, aquatic biome2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
103amnon high in downstream compared to upstream in particles river united states of america mississippi river fresh water aquatic biome 2017-04-05v4No1 / 1032
618amnon high in early flowering stage compared to late flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 1040
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
507amnon high in sediment depth 0-5cm compared to sediment depth 8-10cm in lake sediment sediment canada quesnel lake province of british columbia 2019-03-17v4No1 / 1157
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
800amnoncommon 7-18 days following heavy metal contamination (common spring, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 1248
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to autumn summer in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 1962
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 2266
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org