Search result for sequence:
TACGGGGGGTGCAAGCGTTAATCGGAATGACTGGGCGTAAAGGGCATGTAGGCGGTCCGACAAGTTAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTAAAACTGTCGAACTAGAGTATTGTAGAGGAAGGTAGAATTCCATG
common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
515amnonhighfreq carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 8
515amnonhighfreq bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 10
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 11
515amnonhighfreq carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 12
515amnonhighfreq carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 13
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus limnophilus2019-04-18v4No1 / 16
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus riparius2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 25
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v4No1 / 45
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v4No1 / 322
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v4No1 / 533
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130

Problems / suggestions? Please email info AT dbbact DOT org