dbBact sequence annotation

×

Search result for sequence:

TACGTAAGAGACTAGTGTTATTCATCTTAAATAGGTTTAAAGGGTACCCAAGCTGTAAAATTTGCCTAAAATTAGGGAACAATTTTACTAGAGTTTTATATGAGAAGGTCGTACCAAGGGAGAAGAGTTTGAATTTGATGATACTTTTGG

Taxonomy: d__Bacteria

species	# matches	SILVA IDs

common ontology terms

term enrichment score

Term	Score
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
campinas	0.500000
saccharum	0.400000
sugarcane	0.400000
root endosphere	0.333333
greenhouse	0.250000
brazil	0.190476
root	0.117647
LOWER IN rhizosphere	0.040816
soil	0.019417

Fraction of dbbact annotations with this term covered by the query

Term	Score
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
campinas	0.500000
saccharum	0.333333
sugarcane	0.333333
root endosphere	0.250000
greenhouse	0.166667
brazil	0.105263
root	0.066667
LOWER IN rhizosphere	0.021277
soil	0.009901

Fraction of annotations for the query sequences containing the term

Term	Score
brazil	1.000000
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
root endosphere	0.500000
root	0.500000
LOWER IN rhizosphere	0.500000
soil	0.500000
saccharum	0.500000
sugarcane	0.500000
campinas	0.500000
greenhouse	0.500000

Exp. ID	User ID	Description	Date	Region	Flag	Sequences
615	amnon	high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse	2020-04-27	v4	No	1 / 306
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root	2019-08-17	v4	No	1 / 575

Problems / suggestions? Please email info AT dbbact DOT org