Search result for sequence:
TACGTAGGAGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGAGGGCGTAGGCGGCTTTTCAAGTCGGATGTGAAATTTCCCGGCTCAACCGGGACGGGTCATTCGATACTGTTGGGCTAGAGGACGGCAGGAGGAGATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
mangrove swamp0.800000
mangrove0.521739
spartina alterniflora0.400000
kandelia candel0.363636
dongzhaigang national nature reserve0.363636
leizhou nature reserve0.363636
hainan autonomous prefecture0.307692
guangdong province0.307692
depth 0-20cm0.228571
avicennia germinans0.222222
rhizophora mangle0.222222
saline marsh0.222222
mudflat0.222222
low salinity0.200000
LOWER IN high salinity0.200000
atlantic ocean0.133333
marine sediment0.126984
rhizosphere0.100000
state of florida0.090909
sediment0.066667
soil0.060790
china0.036765
united states of america0.019324
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.750000
mangrove0.666667
spartina alterniflora0.666667
avicennia germinans0.500000
rhizophora mangle0.500000
saline marsh0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
leizhou nature reserve0.500000
low salinity0.333333
LOWER IN high salinity0.333333
hainan autonomous prefecture0.333333
guangdong province0.333333
depth 0-20cm0.142857
atlantic ocean0.125000
marine sediment0.071429
state of florida0.066667
rhizosphere0.060606
sediment0.043478
soil0.031746
china0.018868
united states of america0.010000
Fraction of annotations for the query sequences containing the term
TermScore
mangrove swamp0.857143
soil0.714286
china0.714286
marine sediment0.571429
depth 0-20cm0.571429
mangrove0.428571
united states of america0.285714
rhizosphere0.285714
spartina alterniflora0.285714
kandelia candel0.285714
hainan autonomous prefecture0.285714
dongzhaigang national nature reserve0.285714
guangdong province0.285714
leizhou nature reserve0.285714
state of florida0.142857
avicennia germinans0.142857
rhizophora mangle0.142857
saline marsh0.142857
atlantic ocean0.142857
sediment0.142857
low salinity0.142857
LOWER IN high salinity0.142857
mudflat0.142857

Problems / suggestions? Please email info AT dbbact DOT org