Search result for sequence:
TACGTAGGATGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTCCGTAGGCGGTTTGTTAAGTCTCCTGTGAAAGTTCAGGGCTCAACCCTGAAATGTCGGGGGATACTGGCAAACTTGAGACTGTCAGAGGCAAGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
kandelia candel0.500000
leizhou nature reserve0.500000
ximendao national marine reserve0.500000
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
low activity methane seep0.500000
LOWER IN oil seep0.500000
LOWER IN active methane seep0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
spartina alterniflora0.333333
depth 500-1000m0.333333
mangrove swamp0.250000
state of oregon0.200000
zhejiang province0.166667
depth 0-20cm0.142857
marine sediment0.071429
ocean0.062500
pacific ocean0.058824
sediment0.043478
soil0.015873
china0.009434
Fraction of annotations for the query sequences containing the term
TermScore
china0.888889
soil0.888889
mangrove swamp0.888889
marine sediment0.888889
depth 0-20cm0.888889
zhejiang province0.555556
futian national nature reserve0.333333
mangrove0.333333
kandelia candel0.333333
spartina alterniflora0.333333
mudflat0.222222
guangdong province0.222222
leizhou nature reserve0.222222
ximendao national marine reserve0.222222
hainan autonomous prefecture0.111111
dongzhaigang national nature reserve0.111111
pacific ocean0.111111
ocean0.111111
sediment0.111111
carbonate0.111111
lithified carbonate blocks0.111111
depth 500-1000m0.111111
hydrate ridge0.111111
state of oregon0.111111
low activity methane seep0.111111
LOWER IN oil seep0.111111
LOWER IN active methane seep0.111111
Exp. ID User ID Description Date Region Flag Sequences
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-19v4No1 / 1791

Problems / suggestions? Please email info AT dbbact DOT org