Search result for sequence:
TACGTAGGCAGCAAGCGTTGTTCGGAGTTACTGGGCGTAAAGGGTGCGTAGGCGGCTCTATAAGTATGGTGTGAAATCTCCCGGCTTAACTGGGAGGGTGCGCTATAGACTGTGGGGCTAGAGGGTGGGAGAGGAAAGTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
agricultural field0.355828
soil0.317460
grand river watershed0.255319
rare charitable research reserve0.255319
alabama0.186047
ultisol0.186047
luvisol0.186047
cambridge0.184615
auburn0.170213
province of ontario0.169014
dekalb county0.146341
illinois0.146341
quercus velutina0.146341
quercus alba0.146341
quercus rubra0.146341
acer saccharum0.146341
acer saccharum subsp. nigrum0.146341
fagus grandifolia0.146341
forest0.146341
lettuce0.132231
triticum aestivum0.130435
rhizosphere0.129330
forested area0.120000
upland soil0.117647
pot expreiment0.116788
kingdom of denmark0.113475
bulk soil0.108108
park0.105263
thyrow0.102564
depth 0-15cm0.102564
depth 15-30cm0.102564
mature forest0.102564
brunisol0.102564
dipsacus fullonum0.102564
solidago0.102564
apocynum0.102564
decomissioned agricultural field0.102564
meadow ecosystem0.102564
state of illinois0.101695
depth (soil) 0-20cm0.101033
daucus carota0.097561
depth (soil) 0-10cm0.096386
germany0.094488
switzerland0.090909
oak0.086957
mineral fertilization0.086957
cosumnes river preserve0.086957
sacramento0.086957
flood plain0.086957
foot slope 0.086957
hapludalf0.086957
alfisol0.086957
depth 30-45cm0.086957
quercus0.083333
npk fertilization0.083333
haplic luvisol0.083333
silt loam0.083333
sandy loam0.083333
sandy loam soil0.083333
zea mays0.082192
depth (soil) 0-30 cm0.080000
ph 4-50.072727
depth (soil) 10-25cm0.072072
minas gerais state0.070796
campos rupestres0.070796
albic luvisol0.070796
crop rotation0.070796
bernburg0.070796
late weichselian glaciation0.070796
clayey till0.070796
lund0.070796
calcic chernozem0.070796
south moravian region0.070796
colluvial soil0.070796
loam soil0.068376
mollisol0.068376
ph 80.068376
luancheng county0.068376
wheat0.064000
ph 70.064000
fertilized soil0.064000
ph 7.60.062016
czech republic0.058394
china0.057962
canada0.055814
cinnamomum camphora0.055556
anxi county0.055556
maize field0.054054
ph 6.40.054054
preston flats0.054054
old growth forest0.054054
topsoil0.050633
surface water0.048780
japan0.045977
united kingdom0.044444
brazil0.044199
state of california0.041667
volcan sumaco0.037383
vellozia epidendroides0.036697
elevation 2000-3000m0.036697
Fraction of dbbact annotations with this term covered by the query
TermScore
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
xiyuan river1.000000
fuzhou city prefecture1.000000
river water1.000000
park0.666667
depth (soil) 10-25cm0.666667
central park0.500000
ph 5.40.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
agricultural field0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
neve yaar0.500000
clay soil0.500000
oak0.500000
acute oak decline0.500000
lower saxony0.500000
sandy soil0.500000
maize field0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
LOWER IN organic fertilization0.500000
therwil0.500000
LOWER IN bio-dynamic fertilizer0.500000
bio-dynamic fertilizer0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
cultivator tillage0.500000
maize pre-crop0.500000
rapeseed pre-crop0.500000
chromic cambisol0.500000
bretagne region0.500000
cosumnes river preserve0.500000
sacramento0.500000
flood plain0.500000
depth (soil) 100-133cm0.500000
apricot0.500000
prunus armeniaca0.500000
apennine mountains0.500000
okinawa islands0.500000
LOWER IN normal weather0.500000
tropical storm0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
depth 50-70cm0.500000
depth 70-100cm0.500000
LOWER IN depth 70-100cm0.500000
foot slope 0.500000
depth 30-50cm0.500000
depth 50-90cm0.500000
depth 90-100cm0.500000
plough layer 0.500000
late weichselian glaciation0.500000
clayey till0.500000
lund0.500000
sandy till 0.500000
depth 70-120cm0.500000
depth 200-260cm0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 27-56cm0.500000
depth 56-116cm0.500000
depth 116-140cm0.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
depth 12-44cm0.500000
depth 44-108cm0.500000
depth 108-140cm0.500000
LOWER IN depth 12-44cm0.500000
LOWER IN depth 200-350cm0.500000
depth 20-120cm0.500000
depth 30-60cm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.800000
agricultural field0.276190
grand river watershed0.171429
canada0.171429
province of ontario0.171429
cambridge0.171429
rare charitable research reserve0.171429
united states of america0.142857
china0.123810
rhizosphere0.114286
auburn0.114286
alabama0.114286
ultisol0.114286
luvisol0.114286
depth (soil) 0-20cm0.104762
germany0.095238
triticum aestivum0.085714
dekalb county0.085714
illinois0.085714
state of illinois0.085714
quercus velutina0.085714
quercus alba0.085714
quercus rubra0.085714
acer saccharum0.085714
acer saccharum subsp. nigrum0.085714
fagus grandifolia0.085714
forest0.085714
forested area0.085714
kingdom of denmark0.076190
lettuce0.076190
pot expreiment0.076190
bulk soil0.066667
upland soil0.066667
park0.057143
depth (soil) 0-10cm0.057143
switzerland0.057143
thyrow0.057143
depth 0-15cm0.057143
depth 15-30cm0.057143
mature forest0.057143
brunisol0.057143
dipsacus fullonum0.057143
solidago0.057143
apocynum0.057143
daucus carota0.057143
decomissioned agricultural field0.057143
meadow ecosystem0.057143
depth (soil) 0-30 cm0.047619
united kingdom0.047619
oak0.047619
quercus0.047619
zea mays0.047619
mineral fertilization0.047619
npk fertilization0.047619
haplic luvisol0.047619
silt loam0.047619
cosumnes river preserve0.047619
sacramento0.047619
state of california0.047619
flood plain0.047619
foot slope 0.047619
sandy loam0.047619
sandy loam soil0.047619
hapludalf0.047619
alfisol0.047619
depth 30-45cm0.047619
ph 4-50.047619
minas gerais state0.038095
campos rupestres0.038095
brazil0.038095
wheat0.038095
ph 70.038095
albic luvisol0.038095
crop rotation0.038095
ph 7.60.038095
bernburg0.038095
depth (soil) 10-25cm0.038095
loam soil0.038095
late weichselian glaciation0.038095
clayey till0.038095
lund0.038095
mollisol0.038095
ph 80.038095
calcic chernozem0.038095
czech republic0.038095
south moravian region0.038095
colluvial soil0.038095
luancheng county0.038095
fertilized soil0.038095
topsoil0.028571
japan0.028571
maize field0.028571
ph 6.40.028571
surface water0.028571
preston flats0.028571
old growth forest0.028571
cinnamomum camphora0.028571
anxi county0.028571
farm0.028571
vellozia epidendroides0.019048
Exp. ID User ID Description Date Region Flag Sequences
964amnondominant volcan sumaco, ecuador, depth (soil) 10-25cm, soil, ph 4-5, stratovolcano2022-12-21v3No1 / 8
989amnondominant soil, china, farm, ph 4-5, anxi county, cinnamomum camphora, depth (soil) 0-20cm2022-12-26v3No1 / 10
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 17
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in mineral fertilization npk fertilization compared to manured soil manure fertilization organic fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 38
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 127
662amnon high in irrigated compared to dry in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 146
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 182
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 295
786sheryoHigher at 60-100cm depth compared to 133-166cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 133-166cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-14v3No1 / 300
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
786sheryoHigher at 30-60cm depth compared to 0-30cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth (soil) 0-30 cm depth (soil) 0-20cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 675
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 768
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 878
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
854sheryoCommon in soil depth of 200-250cm of colluvial soil, Czech rebuplic (common depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 894
996amnon high in upstream compared to city anthropogenic environmental material downstream in river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 894
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
854sheryoCommon in soil depth of 125-175cm of colluvial soil, Czech rebuplic (common depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 962
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1015
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1142
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770

Problems / suggestions? Please email info AT dbbact DOT org