Search result for sequence:
TACGTAGGCGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAACTAAGCGGATCTTAAAAGTGCGGGGCTCAACCCCGTGATGGGGTCCGAACTGGTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT
common ontology terms
term enrichment score
TermScore
canis lupus familiaris0.289741
feces0.288843
homo sapiens0.246308
dog0.239468
adult0.229260
china0.200967
united states of america0.141767
urocyon littoralis catalinae0.123223
santa catalina island fox0.123223
santa catalina island0.123223
urocyon littoralis0.123223
age 6 weeks0.108197
research facility0.107328
italy0.096475
caecum0.090000
wild0.088050
control0.087086
chicken0.086124
gallus gallus0.086124
kingdom of spain0.084014
lamb0.081448
new zealand0.081448
rectum0.075591
sheep0.070039
jiangsu province0.068670
ovis aries0.065455
city0.064665
south korea0.060914
farm0.057052
male0.056604
obsolete_juvenile stage0.055814
pig0.055046
child0.053933
rat0.052174
wastewater treatment plant0.051724
free range chicken0.051282
india0.050847
duodenum0.049587
river0.048780
infant0.047619
water0.045369
rattus norvegicus0.043478
sprague dawley0.043478
colon0.042328
canada0.041885
poland0.041451
age 60-790.041451
age 130.041451
age 30-500.041451
guangzhou city prefecture0.040609
jiangxi province0.039801
juvenile organism0.039024
ileum0.038647
fresh water0.038035
mouse0.035191
sus scrofa0.034934
mus musculus0.033149
LOWER IN colon0.031915
labial commissure0.031414
perianal skin0.031414
colonized germ free0.031414
seattle0.031414
preweaned0.031414
age 2-4 weeks0.031414
suckling0.031414
state of louisiana0.031414
beagle dog0.031414
janvier labs0.031414
age 50-60 years0.031414
nanning city prefecture0.031414
peromyscus maniculatus0.031414
deer mice0.031414
province of ontario0.031414
algonquin provincial park0.031414
effluent0.031414
lip0.030928
age 19-240.030928
zhejiang province0.030928
age 3-5 weeks0.030928
jejunum0.030457
captive0.030000
zoological garden0.029777
air0.029777
pair of nares0.029557
israel0.029126
female0.028881
c57bl/6j0.027907
age0.027714
saliva0.027650
germany0.026432
skin0.026258
LOWER IN control0.024316
external ear0.021164
sus scrofa domesticus0.021164
obesity0.021164
emperor tamarin0.021164
saguinus imperator0.021164
como zoo0.021164
lymphoma0.021164
external naris0.021164
Fraction of dbbact annotations with this term covered by the query
TermScore
colon1.000000
LOWER IN colon1.000000
canis lupus familiaris0.684211
dog0.666667
canada0.666667
age 6 weeks0.600000
caecum0.600000
wastewater treatment plant0.600000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
external ear0.500000
sus scrofa domesticus0.500000
poland0.500000
obesity0.500000
emperor tamarin0.500000
saguinus imperator0.500000
como zoo0.500000
lymphoma0.500000
free range chicken0.500000
labial commissure0.500000
age 60-790.500000
external naris0.500000
perianal skin0.500000
cftr s489x0.500000
colonized germ free0.500000
seattle0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
iowa0.500000
state of louisiana0.500000
beagle dog0.500000
stroke0.500000
age 130.500000
spondyloarthritis0.500000
spondylitis0.500000
type 2 diabetes mellitus0.500000
south korea0.500000
gout0.500000
third trimester0.500000
age 30-500.500000
induced type 1 diabetes0.500000
flagstaff0.500000
janvier labs0.500000
age 18 weeks0.500000
very high sugar diet0.500000
LOWER IN high sugar diet0.500000
age 13-140.500000
LOWER IN induced type 1 diabetes0.500000
tiger0.500000
panthera tigris0.500000
LOWER IN diarrhea0.500000
ulcerative colitis0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
bedroom0.500000
LOWER IN no dog0.500000
rheumatoid arthritis0.500000
LOWER IN switzerland0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
common bottlenose dolphin0.500000
age <1 year0.500000
wild cat0.500000
felis silvestris0.500000
nanchang city prefecture0.500000
peromyscus maniculatus0.500000
deer mice0.500000
province of ontario0.500000
algonquin provincial park0.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
high sugar diet0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
LOWER IN external acoustic meatus0.500000
LOWER IN ear canal0.500000
LOWER IN estonia0.500000
low income0.500000
sewer0.500000
wood mouse0.500000
apodemus sylvaticus0.500000
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
anterior naris0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.643243
homo sapiens0.410811
china0.297297
united states of america0.281081
adult0.259459
canis lupus familiaris0.183784
research facility0.167568
dog0.145946
control0.091892
wild0.075676
urocyon littoralis catalinae0.070270
santa catalina island fox0.070270
santa catalina island0.070270
urocyon littoralis0.070270
italy0.070270
age 6 weeks0.059459
lamb0.048649
new zealand0.048649
ovis aries0.048649
sheep0.048649
chicken0.048649
gallus gallus0.048649
caecum0.048649
kingdom of spain0.048649
farm0.048649
jiangsu province0.043243
rectum0.043243
city0.037838
male0.032432
rat0.032432
pig0.032432
mus musculus0.032432
mouse0.032432
obsolete_juvenile stage0.032432
south korea0.032432
child0.032432
water0.032432
duodenum0.027027
rattus norvegicus0.027027
sprague dawley0.027027
free range chicken0.027027
india0.027027
infant0.027027
wastewater treatment plant0.027027
river0.027027
ileum0.021622
poland0.021622
colon0.021622
age 60-790.021622
guangzhou city prefecture0.021622
sus scrofa0.021622
jiangxi province0.021622
age 130.021622
juvenile organism0.021622
female0.021622
age 30-500.021622
LOWER IN control0.021622
canada0.021622
fresh water0.021622
jejunum0.016216
zoological garden0.016216
lip0.016216
labial commissure0.016216
age 19-240.016216
pair of nares0.016216
perianal skin0.016216
colonized germ free0.016216
seattle0.016216
preweaned0.016216
age 2-4 weeks0.016216
suckling0.016216
zhejiang province0.016216
state of louisiana0.016216
beagle dog0.016216
skin0.016216
israel0.016216
germany0.016216
c57bl/6j0.016216
janvier labs0.016216
age 50-60 years0.016216
nanning city prefecture0.016216
air0.016216
saliva0.016216
peromyscus maniculatus0.016216
deer mice0.016216
age 3-5 weeks0.016216
province of ontario0.016216
algonquin provincial park0.016216
captive0.016216
age0.016216
LOWER IN colon0.016216
effluent0.016216
external ear0.010811
cecal content0.010811
axilla0.010811
small village0.010811
rural community0.010811
sus scrofa domesticus0.010811
obese body mass index status0.010811
obesity0.010811
Exp. ID User ID Description Date Region Flag Sequences
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 5
649amnondominant jejunum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 5
649amnondominant ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 8
649amnondominant duodenum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 9
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 11
604amnondominant chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 12
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 15
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 15
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 16
290amnondominant homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 16
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 16
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 17
625amnondominant emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 17
488amnondominant canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 17
495amnondominant gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 17
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 17
301amnondominant canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 18
401amnondominant homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 18
438amnondominant homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 18
438amnondominant feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 18
573amnondominant feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 18
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 18
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 18
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 19
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 19
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 19
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 19
72amnondominant canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 20
666amnondominant canis lupus familiaris, dog, italy, feces2020-09-25v3No1 / 20
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 20
648amnondominant state of louisiana, feces, canis lupus familiaris, dog2020-09-06v4No1 / 21
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 21
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 21
61amnondominant canis lupus familiaris, united states of america, skin, inguinal region, research facility2017-02-05v4No1 / 22
197amnondominant feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 22
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 22
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 22
643amnondominant adult, south korea, feces, homo sapiens2020-08-30v4No1 / 23
150amnondominant canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 23
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 23
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 23
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 24
301amnondominant canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 25
438amnondominant feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 25
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 25
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 26
488amnondominant canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 26
540amnoncommon dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 27
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 27
231amnonhigh freq. in dog rectum (dominant dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 28
438amnondominant homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 28
573amnoncommon feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 29
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 33
649amnoncommon jejunum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 37
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 37
666amnoncommon tiger, panthera tigris, italy, feces2020-09-25v3No1 / 43
649amnoncommon duodenum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 44
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 46
666amnoncommon canis lupus familiaris, dog, italy, feces2020-09-25v3No1 / 46
16amnon high in control compared to diarrhea in felis catus state of california feces 2016-11-08v4No1 / 50
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 51
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 52
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 54
649amnoncommon ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 54
648amnon high in control compared to antibiotic metronidazole in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v4No1 / 55
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 55
523amnonhigher in houses with dogs ( high in dog canis lupus familiaris compared to no dog in air building bedroom united states of america chicago state of illinois )2019-07-03v4No1 / 58
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 60
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 60
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 61
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 63
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 67
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 68
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 68
663amnon high in poland compared to switzerland in adult feces homo sapiens 2020-09-22v4No1 / 71
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 75
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 76
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 76
596amnon high in age <1 year compared to age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 77
301amnon high in colon rectum compared to duodenum ileum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 78
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 80
648amnoncommon united states of america, dog, canis lupus familiaris, feces, state of louisiana2020-09-06v4No1 / 82
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 83
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 84
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 87
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 91
666amnoncommon wild cat, felis silvestris, italy, feces2020-09-25v3No1 / 91
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 92
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 93
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 95
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 100
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 104
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 105
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 106
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 107
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 108
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 110
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 111
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 114
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 115
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 120
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 123
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 125
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 127
649amnoncommon colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 127
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 130
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 131
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 133
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 135
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 139
582amnon high in labial commissure lip compared to external acoustic meatus ear canal in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 141
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 145
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 147
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 154
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 161
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 162
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 169
666amnoncommon italy, feces, wood mouse, apodemus sylvaticus2020-09-25v3No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 171
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 172
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 188
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 188
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 188
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 196
495amnon high in free range chicken compared to broiler chicken in gallus gallus chicken caecum kingdom of spain farm age 3 weeks 2019-03-03v4No1 / 198
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 202
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 207
669amnon high in age 1 year compared to age 2 months in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 213
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 217
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 220
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 220
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 238
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 252
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 262
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 271
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 277
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 280
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 287
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 287
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 289
649amnon high in jejunum duodenum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 294
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 318
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 319
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 324
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 327
649amnon high in ileum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 337
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 346
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 346
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 355
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 367
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 372
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 375
108amnon high in caecum compared to colon in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 379
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 399
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 415
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 421
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 439
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 468
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 485
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 556
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 572
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 591
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 654
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 764

Problems / suggestions? Please email info AT dbbact DOT org