Search result for sequence:
TACGTAGGGACCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCAATTCAAGTCATCTGTGAAATCTCCGGGCTTAACTCGGAACGGTCAGATGATACTGCTTTGCTAGAGTGCGGAAGGGGCAATCGGAATTCTTGG
common ontology terms
term enrichment score
TermScore
kellogg biological station0.371134
mesic type hapludalf0.371134
kalamazoo loam0.371134
soil0.291715
restored prairie0.227848
ph 60.195804
state of idaho0.188235
panicum virgatum0.186667
miscanthus0.164384
corn0.151899
depth (soil) 10-25cm0.151899
state of michigan0.149378
rhizosphere0.148148
nicollet soil series0.140845
des moines0.140845
united states0.140845
iowa0.131579
depth (soil) 25-50cm0.131579
depth (soil) 0-10cm0.131455
boechera stricta0.115942
continuous corn0.115942
depth (soil) 0-15cm0.109589
glycine max0.106667
root0.101523
woodland area0.096386
zea mays0.090090
svalbard archipelago0.089552
minas gerais state0.089552
campos rupestres0.089552
subsurface drainage0.089552
kelley0.089552
depth 50-100m0.089552
oryza sativa0.088235
agricultural field0.082645
brassicaceae0.082474
permafrost0.082192
depth (soil) 20-30cm0.082192
LOWER IN root0.078947
kingdom of norway0.070588
topsoil0.068182
forest ecosystem0.068182
temperate grassland biome0.061538
flooded grassland biome0.061538
rice0.061538
tomato0.061538
slit loam soil0.061538
ph 5.50.061538
quesnel lake0.061538
barbacenia macrantha0.061538
coarse-loamy soil0.061538
day 820.061538
kanawha0.061538
LOWER IN depth (soil) 60-90cm0.061538
fen0.059701
pasture0.059701
depth (soil) 0-5cm0.059701
united states of america0.058532
peat soil0.057971
cultivated environment0.057971
province of british columbia0.057971
sediment depth 0-5cm0.057971
canada0.056604
lake sediment0.056338
solanum lycopersicum0.053333
farm0.051502
brazil0.050847
state of new york0.045977
united kingdom0.036697
plant0.033755
maryland county0.031746
non-seleniferous0.031746
LOWER IN seleniferous0.031746
central park0.031746
ph 6-6.50.031746
myrtillocactus geometrizans0.031746
opuntia robusta0.031746
root zone soil0.031746
LOWER IN permafrost transition layer0.031746
LOWER IN depth 100-150cm0.031746
LOWER IN depth 150-200cm0.031746
subpolar coniferous forest biome0.031746
boreal forest0.031746
ph>30.031746
LOWER IN ph<30.031746
southern temperate forest0.031746
temperate broadleaf and mixed forest biome0.031746
reunion island0.031746
LOWER IN stover amended0.031746
cannabis sativa0.031746
ph 7.10.031746
ph 6.20.031746
temperate rainforest0.031746
olympic national park0.031746
LOWER IN selenium0.031250
depth 20cm0.031250
park0.031250
cactus0.031250
semi-arid0.031250
ph 5.60.031250
soybean0.031250
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 60.666667
maryland county0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
central park0.500000
ph 6-6.50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
ph 5.50.500000
boechera stricta0.500000
svalbard archipelago0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph>30.500000
LOWER IN ph<30.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
reunion island0.500000
quesnel lake0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
LOWER IN stover amended0.500000
cannabis sativa0.500000
kanawha0.500000
ph 7.10.500000
nicollet soil series0.500000
des moines0.500000
united states0.500000
LOWER IN depth (soil) 60-90cm0.500000
subsurface drainage0.500000
ph 6.20.500000
kelley0.500000
temperate rainforest0.500000
olympic national park0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
depth 50-100m0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
oryza sativa0.428571
LOWER IN selenium0.333333
depth 20cm0.333333
fen0.333333
park0.333333
cactus0.333333
semi-arid0.333333
ph 5.60.333333
state of idaho0.333333
soybean0.333333
paddy field soil0.333333
heilongjiang province0.333333
pasture0.333333
LOWER IN sediment depth 8-10cm0.333333
depth (soil) 0-5cm0.333333
unamended soil0.333333
depth (soil) 0-15cm0.333333
iowa0.333333
depth (soil) 15-30cm0.333333
ph 5.90.333333
corn0.333333
depth (soil) 10-25cm0.333333
depth (soil) 25-50cm0.333333
LOWER IN depth (soil) 25-50cm0.333333
glycine max0.285714
peat soil0.250000
urban biome0.250000
LOWER IN root structure0.250000
permafrost0.250000
depth (soil) 20-30cm0.250000
orchard0.250000
cultivated environment0.250000
province of british columbia0.250000
sediment depth 0-5cm0.250000
root endosphere0.250000
LOWER IN root endosphere0.250000
depth 5cm0.200000
LOWER IN root0.200000
citrus0.200000
new zealand0.200000
ireland0.200000
lake sediment0.200000
forested area0.200000
state of washington0.200000
ph 6.50.200000
woodland area0.181818
Fraction of annotations for the query sequences containing the term
TermScore
soil0.803279
united states of america0.557377
state of michigan0.295082
kellogg biological station0.295082
mesic type hapludalf0.295082
kalamazoo loam0.295082
restored prairie0.147541
rhizosphere0.131148
state of idaho0.131148
ph 60.114754
depth (soil) 0-10cm0.114754
panicum virgatum0.114754
corn0.098361
depth (soil) 10-25cm0.098361
miscanthus0.098361
root0.081967
nicollet soil series0.081967
des moines0.081967
united states0.081967
agricultural field0.081967
iowa0.081967
zea mays0.081967
depth (soil) 25-50cm0.081967
woodland area0.065574
brassicaceae0.065574
boechera stricta0.065574
plant0.065574
glycine max0.065574
depth (soil) 0-15cm0.065574
continuous corn0.065574
oryza sativa0.049180
LOWER IN root0.049180
kingdom of norway0.049180
svalbard archipelago0.049180
permafrost0.049180
depth (soil) 20-30cm0.049180
topsoil0.049180
forest ecosystem0.049180
farm0.049180
canada0.049180
minas gerais state0.049180
campos rupestres0.049180
brazil0.049180
subsurface drainage0.049180
kelley0.049180
depth 50-100m0.049180
temperate grassland biome0.032787
fen0.032787
peat soil0.032787
flooded grassland biome0.032787
united kingdom0.032787
rice0.032787
solanum lycopersicum0.032787
tomato0.032787
slit loam soil0.032787
ph 5.50.032787
china0.032787
cultivated environment0.032787
pasture0.032787
lake sediment0.032787
sediment0.032787
quesnel lake0.032787
province of british columbia0.032787
sediment depth 0-5cm0.032787
barbacenia macrantha0.032787
depth (soil) 0-5cm0.032787
state of new york0.032787
coarse-loamy soil0.032787
day 820.032787
kanawha0.032787
LOWER IN depth (soil) 60-90cm0.032787
maryland county0.016393
leaf0.016393
control0.016393
LOWER IN solanum lycopersicum0.016393
LOWER IN selenium0.016393
non-seleniferous0.016393
LOWER IN seleniferous0.016393
depth 20cm0.016393
depth 5cm0.016393
urban biome0.016393
park0.016393
new york city0.016393
central park0.016393
ph 6-6.50.016393
mexico0.016393
myrtillocactus geometrizans0.016393
opuntia robusta0.016393
cactus0.016393
semi-arid0.016393
root zone soil0.016393
ph 5.60.016393
state of california0.016393
LOWER IN leaf0.016393
depth (soil) 0-20cm0.016393
LOWER IN root structure0.016393
soybean0.016393
LOWER IN depth (soil) 0-20cm0.016393
LOWER IN permafrost transition layer0.016393
LOWER IN depth 100-150cm0.016393
Exp. ID User ID Description Date Region Flag Sequences
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
507amnoncommon lake sediment, sediment, canada, quesnel lake, province of british columbia, sediment depth 0-5cm2019-03-17v4No1 / 604
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 930
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
507amnon high in sediment depth 0-5cm compared to sediment depth 8-10cm in lake sediment sediment canada quesnel lake province of british columbia 2019-03-17v4No1 / 1157
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org