Search result for sequence:
TACGTAGGGACCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCGTGACAAGTCACTTGTGAAATCTCTGGGCTTAACCCAGAACGGCCAAGTGAAACTGTTGTGCTAGAGTGCGGAAGGGGCAATCGGAATTCTCGG
common ontology terms
term enrichment score
TermScore
agricultural field0.311111
soil0.277528
wheat0.254237
triticum aestivum0.214984
bulk soil0.210526
maize field0.196262
rhizosphere0.184186
luvisol0.162162
grand river watershed0.162162
rare charitable research reserve0.162162
zea mays0.146341
cambridge0.130435
ph 7.60.129870
province of ontario0.122449
switzerland0.118343
kingdom of denmark0.118343
ph 80.117647
kaiyang county0.114286
guizhou province0.114286
lettuce0.114286
crop rotation0.114286
bernburg0.114286
dekalb county0.114286
illinois0.114286
depth 0-15cm0.114286
preston flats0.114286
ph 7-80.106762
depth (soil) 0-10cm0.105820
depth (soil) 0-20cm0.104673
pot expreiment0.102564
germany0.102439
ph 70.097561
north china plain0.088235
minas gerais state0.088235
campos rupestres0.088235
after 6 years0.088235
neve yaar0.088235
depth (soil) 0-30 cm0.088235
organic fertilization0.088235
bio-dynamic fertilizer0.088235
flood plain0.088235
sacramento0.088235
cosumnes river preserve0.088235
calcic chernozem0.088235
south moravian region0.088235
colluvial soil0.088235
fertilized soil0.086331
state of illinois0.085106
manure fertilization0.084507
haplic luvisol0.084507
canada0.083832
manured soil0.075000
czech republic0.069767
jinxiang county0.062500
loam soil0.061538
israel0.061538
barbacenia macrantha0.060606
elevation 2000-3000m0.060606
canton of graubunden0.060606
lower saxony0.060606
sandy soil0.060606
thyrow0.060606
therwil0.060606
apricot0.060606
prunus armeniaca0.060606
apennine mountains0.060606
depth 0-12cm0.060606
hapludalf0.060606
alfisol0.060606
LOWER IN depth 15-30cm0.060606
dipsacus fullonum0.060606
solidago0.060606
apocynum0.060606
decomissioned agricultural field0.060606
meadow ecosystem0.060606
garlic0.058824
allium sativum0.058824
mountain0.058824
unamended soil0.058824
depth (soil) 10 cm0.058824
mollisol0.058824
sandy loam0.058824
sandy loam soil0.058824
daucus carota0.058824
agricultural feature0.057692
irrigated0.057143
orchard0.057143
china0.056718
ph 50.055556
silt loam0.054054
biochar0.051282
farm0.051064
winter0.050420
brazil0.050420
state of california0.041958
italy0.037736
LOWER IN high npk fertilizer dose0.031746
low npk fertilizer dose0.031746
banana0.031746
musa acuminata0.031746
Fraction of dbbact annotations with this term covered by the query
TermScore
jinxiang county1.000000
LOWER IN high npk fertilizer dose1.000000
low npk fertilizer dose1.000000
banana1.000000
musa acuminata1.000000
maize field0.750000
ph 80.666667
loam soil0.666667
wheat0.600000
bulk soil0.571429
seleniferous0.500000
LOWER IN non-seleniferous0.500000
north china plain0.500000
ph>80.500000
ph>5, ph<60.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
agricultural field0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
kaiyang county0.500000
guizhou province0.500000
after 6 years0.500000
treated wastewater0.500000
neve yaar0.500000
loam0.500000
loamy sand soil0.500000
depth (soil) 0-30 cm0.500000
acute oak decline0.500000
oak0.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
ph 6.60.500000
organic fertilization0.500000
bio-dynamic fertilizer0.500000
therwil0.500000
LOWER IN mineral fertilization0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
cultivator tillage0.500000
maize pre-crop0.500000
rapeseed pre-crop0.500000
bretagne region0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
depth (soil) 100-133cm0.500000
LOWER IN litter bag0.500000
apricot0.500000
prunus armeniaca0.500000
apennine mountains0.500000
okinawa islands0.500000
LOWER IN normal weather0.500000
tropical storm0.500000
LOWER IN depth 50-90cm0.500000
foot slope 0.500000
alabama0.500000
ultisol0.500000
plough layer 0.500000
late weichselian glaciation0.500000
clayey till0.500000
lund0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 0-560.500000
LOWER IN depth 56-1400.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
LOWER IN depth 12-44cm0.500000
LOWER IN depth 30-60cm0.500000
depth 0-15cm0.500000
preston flats0.500000
luvisol0.500000
grand river watershed0.500000
rare charitable research reserve0.500000
depth 15-30cm0.500000
depth 30-45cm0.500000
LOWER IN depth 15-30cm0.500000
dipsacus fullonum0.500000
solidago0.500000
apocynum0.500000
decomissioned agricultural field0.500000
meadow ecosystem0.500000
calcic chernozem0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.790323
china0.225806
agricultural field0.225806
rhizosphere0.177419
triticum aestivum0.177419
wheat0.161290
united states of america0.129032
bulk soil0.129032
depth (soil) 0-20cm0.112903
canada0.112903
maize field0.112903
germany0.112903
zea mays0.096774
luvisol0.096774
grand river watershed0.096774
province of ontario0.096774
cambridge0.096774
rare charitable research reserve0.096774
ph 7-80.080645
switzerland0.080645
depth (soil) 0-10cm0.080645
kingdom of denmark0.080645
ph 7.60.080645
ph 70.064516
kaiyang county0.064516
guizhou province0.064516
ph 80.064516
israel0.064516
lettuce0.064516
pot expreiment0.064516
crop rotation0.064516
bernburg0.064516
dekalb county0.064516
illinois0.064516
state of illinois0.064516
depth 0-15cm0.064516
preston flats0.064516
north china plain0.048387
agricultural feature0.048387
winter0.048387
minas gerais state0.048387
campos rupestres0.048387
brazil0.048387
fertilized soil0.048387
farm0.048387
after 6 years0.048387
neve yaar0.048387
depth (soil) 0-30 cm0.048387
manured soil0.048387
manure fertilization0.048387
organic fertilization0.048387
bio-dynamic fertilizer0.048387
haplic luvisol0.048387
flood plain0.048387
state of california0.048387
sacramento0.048387
cosumnes river preserve0.048387
calcic chernozem0.048387
czech republic0.048387
south moravian region0.048387
colluvial soil0.048387
barbacenia macrantha0.032258
jinxiang county0.032258
garlic0.032258
allium sativum0.032258
mountain0.032258
elevation 2000-3000m0.032258
canton of graubunden0.032258
unamended soil0.032258
biochar0.032258
loam soil0.032258
irrigated0.032258
ph 50.032258
lower saxony0.032258
sandy soil0.032258
thyrow0.032258
therwil0.032258
depth (soil) 10 cm0.032258
orchard0.032258
apricot0.032258
prunus armeniaca0.032258
apennine mountains0.032258
italy0.032258
mollisol0.032258
silt loam0.032258
depth 0-12cm0.032258
sandy loam0.032258
sandy loam soil0.032258
hapludalf0.032258
alfisol0.032258
LOWER IN depth 15-30cm0.032258
dipsacus fullonum0.032258
solidago0.032258
apocynum0.032258
daucus carota0.032258
decomissioned agricultural field0.032258
meadow ecosystem0.032258
selenium0.016129
seleniferous0.016129
LOWER IN non-seleniferous0.016129
Exp. ID User ID Description Date Region Flag Sequences
854sheryoHigher at soil depth of 25-100cm compared to soil depth of 125-175cm of colluvial soil, Czech rebuplic ( high in depth 25-100cm compared to depth 125-175cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 70
1008amnon high in low npk fertilizer dose compared to high npk fertilizer dose in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 rhizosphere 2023-01-26v4No1 / 135
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized compared to npk fertilized haplic luvisol Switzerland ( high in manured soil manure fertilization bio-dynamic fertilizer organic fertilization compared to npk fertilization mineral fertilization in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 294
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
662amnon high in treated wastewater wastewater treatment plant compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
662amnon high in dry compared to irrigated in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 782
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1015
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in soil rhizosphere united states of america woodland area )2017-02-28v4No1 / 2259
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508

Problems / suggestions? Please email info AT dbbact DOT org