Search result for sequence:
TACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGTAAGTTAGTTGTGAAATCCCTCGGCTCAACTGAGGAACTGCGACTAAAACTGCTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
chicken0.450928
gallus gallus0.450928
broiler chicken0.292683
caecum0.261941
kingdom of spain0.240000
feces0.212194
homo sapiens0.198582
united states of america0.170158
free range chicken0.153846
adult0.149254
centrocercus urophasianus0.126984
greater sage-grouse0.126984
state of wyoming0.126984
farm0.124352
control0.117763
age 2 weeks0.100840
LOWER IN rural community0.100000
coturnix coturnix0.098361
common quail0.098361
czech republic0.098361
LOWER IN ulcerative colitis0.096774
bird0.096386
age 4 weeks0.096000
LOWER IN crohn's disease0.093750
state of colorado0.091603
texas0.089552
city0.083333
austria0.082192
state of oklahoma0.068966
LOWER IN thailand0.068966
wistar rat0.068966
dog0.068182
LOWER IN exocrine pancreatic insufficiency0.067797
viet nam0.067797
low bmi0.065574
age 6 weeks0.065574
rattus0.065574
LOWER IN high bmi0.064516
united kingdom0.062500
cat0.061538
canis lupus familiaris0.060000
rat0.059701
felis catus0.057971
LOWER IN colon0.057971
research facility0.046154
LOWER IN native american0.035088
american0.035088
LOWER IN arapaho0.035088
LOWER IN cheyenne0.035088
age 14-28 days0.035088
LOWER IN chronic kidney disease0.035088
LOWER IN enzyme supplementation0.035088
LOWER IN egypt0.035088
commonwealth of pennsylvania0.035088
LOWER IN inflammatory bowel disease0.035088
LOWER IN irritable bowel syndrome0.035088
gallbladder0.035088
bile0.035088
cholelithiasis0.035088
oslo0.035088
age 30-400.035088
dermanyssus gallinae0.035088
red poulty mite0.035088
poulty farm0.035088
age 15 - 35 days0.035088
LOWER IN peru0.035088
LOWER IN tunapuco0.035088
age 12 weeks0.035088
canada0.035088
atherosclerosis0.035088
LOWER IN nepal0.035088
LOWER IN himalayas0.035088
gizzard0.035088
LOWER IN crop0.035088
LOWER IN typhlitis0.035088
LOWER IN intestinal disease0.035088
LOWER IN amerindian0.035088
LOWER IN hunter gatherer0.035088
LOWER IN venezuela0.035088
sigmoid colon0.035088
children0.035088
age one year0.035088
LOWER IN age one month0.035088
LOWER IN dnbs induced colitis0.035088
size < 10um0.035088
clear day0.035088
heterosexual0.034483
msw0.034483
LOWER IN gay0.034483
LOWER IN homosexual0.034483
LOWER IN msm0.034483
age 8 weeks0.034483
age 3 weeks0.034483
thailand0.034483
terminal ileum0.034483
dust0.034483
LOWER IN age 1 year0.033898
LOWER IN small village0.033898
LOWER IN disease0.033898
LOWER IN fasting0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
chicken0.833333
gallus gallus0.833333
broiler chicken0.750000
state of oklahoma0.666667
age 2 weeks0.666667
LOWER IN thailand0.666667
wistar rat0.666667
LOWER IN rural community0.600000
LOWER IN native american0.500000
american0.500000
LOWER IN arapaho0.500000
LOWER IN cheyenne0.500000
age 14-28 days0.500000
LOWER IN chronic kidney disease0.500000
coturnix coturnix0.500000
common quail0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
LOWER IN egypt0.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
viet nam0.500000
LOWER IN irritable bowel syndrome0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
oslo0.500000
age 30-400.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
czech republic0.500000
poulty farm0.500000
age 15 - 35 days0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
free range chicken0.500000
age 12 weeks0.500000
canada0.500000
atherosclerosis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
gizzard0.500000
LOWER IN crop0.500000
LOWER IN typhlitis0.500000
LOWER IN intestinal disease0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN dnbs induced colitis0.500000
size < 10um0.500000
clear day0.500000
LOWER IN ulcerative colitis0.428571
age 4 weeks0.400000
low bmi0.333333
heterosexual0.333333
msw0.333333
LOWER IN gay0.333333
LOWER IN homosexual0.333333
LOWER IN msm0.333333
LOWER IN crohn's disease0.333333
age 8 weeks0.333333
age 6 weeks0.333333
age 3 weeks0.333333
thailand0.333333
rattus0.333333
terminal ileum0.333333
dust0.333333
kingdom of spain0.300000
state of colorado0.285714
LOWER IN high bmi0.285714
texas0.250000
LOWER IN age 1 year0.250000
LOWER IN small village0.250000
LOWER IN disease0.250000
caecum0.227273
united kingdom0.222222
cat0.200000
LOWER IN fasting0.200000
LOWER IN infant0.200000
shelled egg0.200000
body mass index0.200000
biopsy0.200000
city0.176471
austria0.166667
LOWER IN hiv infection0.166667
LOWER IN child0.166667
rat0.166667
kingdom of denmark0.166667
LOWER IN colitis0.166667
felis catus0.142857
bird0.142857
LOWER IN colon0.142857
homo sapiens0.132075
Fraction of annotations for the query sequences containing the term
TermScore
feces0.618182
united states of america0.509091
homo sapiens0.400000
chicken0.309091
gallus gallus0.309091
caecum0.309091
farm0.218182
control0.218182
kingdom of spain0.200000
broiler chicken0.181818
adult0.181818
research facility0.090909
free range chicken0.090909
bird0.072727
centrocercus urophasianus0.072727
greater sage-grouse0.072727
state of wyoming0.072727
austria0.054545
age 2 weeks0.054545
age 4 weeks0.054545
state of colorado0.054545
LOWER IN ulcerative colitis0.054545
texas0.054545
coturnix coturnix0.054545
common quail0.054545
canis lupus familiaris0.054545
dog0.054545
city0.054545
LOWER IN crohn's disease0.054545
czech republic0.054545
LOWER IN rural community0.054545
state of oklahoma0.036364
felis catus0.036364
cat0.036364
LOWER IN exocrine pancreatic insufficiency0.036364
low bmi0.036364
LOWER IN high bmi0.036364
LOWER IN thailand0.036364
viet nam0.036364
united kingdom0.036364
age 6 weeks0.036364
rat0.036364
rattus0.036364
wistar rat0.036364
LOWER IN colon0.036364
LOWER IN native american0.018182
american0.018182
LOWER IN arapaho0.018182
LOWER IN cheyenne0.018182
age 14-28 days0.018182
LOWER IN chronic kidney disease0.018182
LOWER IN hiv infection0.018182
state of california0.018182
early timepoints0.018182
LOWER IN fasting0.018182
LOWER IN late timepoints0.018182
LOWER IN enzyme supplementation0.018182
obsolete_juvenile stage0.018182
child0.018182
LOWER IN egypt0.018182
germany0.018182
heterosexual0.018182
msw0.018182
LOWER IN gay0.018182
LOWER IN homosexual0.018182
LOWER IN msm0.018182
commonwealth of pennsylvania0.018182
LOWER IN child0.018182
LOWER IN inflammatory bowel disease0.018182
LOWER IN irritable bowel syndrome0.018182
gallbladder0.018182
bile0.018182
LOWER IN control0.018182
cholelithiasis0.018182
kingdom of norway0.018182
oslo0.018182
age 30-400.018182
LOWER IN infant0.018182
LOWER IN age 1 year0.018182
dermanyssus gallinae0.018182
red poulty mite0.018182
poulty farm0.018182
larval stage0.018182
shelled egg0.018182
age 15 - 35 days0.018182
LOWER IN peru0.018182
LOWER IN small village0.018182
LOWER IN tunapuco0.018182
age 8 weeks0.018182
age 12 weeks0.018182
canada0.018182
atherosclerosis0.018182
age 3 weeks0.018182
LOWER IN nepal0.018182
LOWER IN himalayas0.018182
thailand0.018182
body mass index0.018182
female0.018182
LOWER IN male0.018182
gizzard0.018182
Exp. ID User ID Description Date Region Flag Sequences
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 9
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 21
127amnonhighfreq gallus gallus, chicken, united states of america, caecum, age 14-28 days2017-04-14v4No1 / 28
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in felis catus cat feces united states of america state of colorado )2018-12-25v4No1 / 31
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum coturnix coturnix common quail )2017-04-07v4No1 / 76
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
568amnon high in viet nam compared to thailand in broiler chicken feces chicken gallus gallus 2019-12-08v3No1 / 119
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 134
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
558amnoncommon caecum, bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming2019-09-20v4No1 / 155
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 236
568amnoncommon viet nam, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 272
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
568amnoncommon thailand, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 320
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
558amnon high in caecum compared to colon in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 359
108amnon high in caecum compared to colon in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 380
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
495amnon high in control compared to typhlitis disease intestinal disease in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 412
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
558amnon high in caecum compared to duodenum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 488
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765

Problems / suggestions? Please email info AT dbbact DOT org