Search result for sequence:
TACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGTAAGTTAGTTGTGAAATCCCTCGGCTCAACTGAGGAACTGCGACTAAAACTGCTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
chicken0.427481
gallus gallus0.427481
kingdom of spain0.259843
broiler chicken0.239316
caecum0.230453
homo sapiens0.214485
feces0.213941
free range chicken0.172414
united states of america0.165899
adult0.163934
farm0.133333
control0.126582
age 2 weeks0.114286
czech republic0.113208
LOWER IN rural community0.113208
coturnix coturnix0.111111
common quail0.111111
LOWER IN ulcerative colitis0.109091
age 4 weeks0.108108
LOWER IN crohn's disease0.105263
state of colorado0.102564
texas0.100000
city0.093750
austria0.090909
state of oklahoma0.078431
wistar rat0.078431
dog0.076923
LOWER IN exocrine pancreatic insufficiency0.076923
low bmi0.074074
age 6 weeks0.074074
rattus0.074074
LOWER IN high bmi0.072727
cat0.071429
united kingdom0.070175
felis catus0.066667
canis lupus familiaris0.066667
rat0.066667
research facility0.047695
LOWER IN native american0.040000
american0.040000
LOWER IN arapaho0.040000
LOWER IN cheyenne0.040000
age 14-28 days0.040000
LOWER IN chronic kidney disease0.040000
LOWER IN enzyme supplementation0.040000
LOWER IN egypt0.040000
commonwealth of pennsylvania0.040000
LOWER IN inflammatory bowel disease0.040000
LOWER IN irritable bowel syndrome0.040000
cholelithiasis0.040000
bile0.040000
gallbladder0.040000
oslo0.040000
age 30-400.040000
dermanyssus gallinae0.040000
red poulty mite0.040000
poulty farm0.040000
age 15 - 35 days0.040000
LOWER IN peru0.040000
LOWER IN tunapuco0.040000
age 12 weeks0.040000
atherosclerosis0.040000
LOWER IN nepal0.040000
LOWER IN himalayas0.040000
LOWER IN thailand0.040000
LOWER IN typhlitis0.040000
LOWER IN intestinal disease0.040000
LOWER IN amerindian0.040000
LOWER IN hunter gatherer0.040000
LOWER IN venezuela0.040000
sigmoid colon0.040000
children0.040000
age one year0.040000
LOWER IN age one month0.040000
LOWER IN dnbs induced colitis0.040000
size < 10um0.040000
clear day0.040000
heterosexual0.039216
msw0.039216
LOWER IN gay0.039216
LOWER IN homosexual0.039216
LOWER IN msm0.039216
age 8 weeks0.039216
age 3 weeks0.039216
terminal ileum0.039216
dust0.039216
LOWER IN age 1 year0.038462
LOWER IN small village0.038462
LOWER IN disease0.038462
LOWER IN hiv infection0.037736
LOWER IN fasting0.037736
LOWER IN infant0.037736
egg0.037736
body mass index0.037736
biopsy0.037736
LOWER IN child0.037037
kingdom of denmark0.037037
LOWER IN colitis0.037037
kingdom of norway0.035714
early timepoints0.035088
Fraction of dbbact annotations with this term covered by the query
TermScore
chicken0.800000
gallus gallus0.800000
state of oklahoma0.666667
broiler chicken0.666667
age 2 weeks0.666667
wistar rat0.666667
czech republic0.600000
LOWER IN rural community0.600000
LOWER IN native american0.500000
american0.500000
LOWER IN arapaho0.500000
LOWER IN cheyenne0.500000
age 14-28 days0.500000
LOWER IN chronic kidney disease0.500000
coturnix coturnix0.500000
common quail0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN egypt0.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN irritable bowel syndrome0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
oslo0.500000
age 30-400.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
age 15 - 35 days0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
free range chicken0.500000
age 12 weeks0.500000
atherosclerosis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN thailand0.500000
LOWER IN typhlitis0.500000
LOWER IN intestinal disease0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN dnbs induced colitis0.500000
size < 10um0.500000
clear day0.500000
LOWER IN ulcerative colitis0.428571
age 4 weeks0.400000
low bmi0.333333
heterosexual0.333333
msw0.333333
LOWER IN gay0.333333
LOWER IN homosexual0.333333
LOWER IN msm0.333333
LOWER IN crohn's disease0.333333
age 8 weeks0.333333
age 6 weeks0.333333
age 3 weeks0.333333
rattus0.333333
terminal ileum0.333333
dust0.333333
kingdom of spain0.300000
state of colorado0.285714
LOWER IN high bmi0.285714
cat0.250000
texas0.250000
LOWER IN age 1 year0.250000
LOWER IN small village0.250000
LOWER IN disease0.250000
united kingdom0.222222
LOWER IN hiv infection0.200000
LOWER IN fasting0.200000
LOWER IN infant0.200000
egg0.200000
body mass index0.200000
biopsy0.200000
caecum0.190476
city0.187500
austria0.166667
felis catus0.166667
LOWER IN child0.166667
rat0.166667
kingdom of denmark0.166667
LOWER IN colitis0.166667
homo sapiens0.140000
adult0.135135
feces0.128205
kingdom of norway0.125000
early timepoints0.111111
LOWER IN late timepoints0.111111
rectum0.111111
israel0.111111
dog0.100000
obsolete_juvenile stage0.100000
united states of america0.099448
Fraction of annotations for the query sequences containing the term
TermScore
feces0.645833
united states of america0.500000
homo sapiens0.458333
chicken0.291667
gallus gallus0.291667
caecum0.291667
farm0.250000
control0.250000
kingdom of spain0.229167
adult0.208333
broiler chicken0.145833
research facility0.104167
free range chicken0.104167
austria0.062500
age 2 weeks0.062500
age 4 weeks0.062500
state of colorado0.062500
LOWER IN ulcerative colitis0.062500
texas0.062500
coturnix coturnix0.062500
common quail0.062500
canis lupus familiaris0.062500
dog0.062500
city0.062500
LOWER IN crohn's disease0.062500
czech republic0.062500
LOWER IN rural community0.062500
state of oklahoma0.041667
felis catus0.041667
cat0.041667
LOWER IN exocrine pancreatic insufficiency0.041667
low bmi0.041667
LOWER IN high bmi0.041667
united kingdom0.041667
age 6 weeks0.041667
rat0.041667
rattus0.041667
wistar rat0.041667
LOWER IN native american0.020833
american0.020833
LOWER IN arapaho0.020833
LOWER IN cheyenne0.020833
age 14-28 days0.020833
LOWER IN chronic kidney disease0.020833
LOWER IN hiv infection0.020833
state of california0.020833
early timepoints0.020833
LOWER IN fasting0.020833
LOWER IN late timepoints0.020833
LOWER IN enzyme supplementation0.020833
obsolete_juvenile stage0.020833
child0.020833
LOWER IN egypt0.020833
germany0.020833
heterosexual0.020833
msw0.020833
LOWER IN gay0.020833
LOWER IN homosexual0.020833
LOWER IN msm0.020833
commonwealth of pennsylvania0.020833
LOWER IN child0.020833
LOWER IN inflammatory bowel disease0.020833
LOWER IN irritable bowel syndrome0.020833
LOWER IN control0.020833
cholelithiasis0.020833
bile0.020833
gallbladder0.020833
kingdom of norway0.020833
oslo0.020833
age 30-400.020833
LOWER IN infant0.020833
LOWER IN age 1 year0.020833
dermanyssus gallinae0.020833
red poulty mite0.020833
poulty farm0.020833
egg0.020833
larval stage0.020833
age 15 - 35 days0.020833
LOWER IN peru0.020833
LOWER IN small village0.020833
LOWER IN tunapuco0.020833
age 8 weeks0.020833
age 12 weeks0.020833
canada0.020833
atherosclerosis0.020833
age 3 weeks0.020833
LOWER IN nepal0.020833
LOWER IN himalayas0.020833
LOWER IN thailand0.020833
body mass index0.020833
LOWER IN colon0.020833
female0.020833
LOWER IN male0.020833
LOWER IN typhlitis0.020833
LOWER IN disease0.020833
LOWER IN intestinal disease0.020833
LOWER IN amerindian0.020833
LOWER IN hunter gatherer0.020833
LOWER IN venezuela0.020833
rectum0.020833
Exp. ID User ID Description Date Region Flag Sequences
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 9
497amnonhighfreq chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 21
127amnonhighfreq gallus gallus, chicken, united states of america, caecum, age 14-28 days2017-04-14v4No1 / 28
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in felis catus cat feces united states of america state of colorado )2018-12-25v4No1 / 31
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum coturnix coturnix common quail )2017-04-07v4No1 / 76
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to exocrine pancreatic insufficiency enzyme supplementation in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
526amnon high in cholelithiasis compared to control in kingdom of spain adult bile gallbladder homo sapiens 2019-07-14v3No1 / 131
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 134
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, egg, larval stage2017-08-14v4No1 / 158
379amnoncommon gallus gallus, chicken, feces, united kingdom, age 15 - 35 days2018-09-14v4No1 / 160
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 3 weeks2019-03-03v4No1 / 236
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
108amnon high in caecum compared to colon in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 380
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
495amnon high in control compared to typhlitis disease intestinal disease in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 412
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to colitis dnbs induced colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765

Problems / suggestions? Please email info AT dbbact DOT org