Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCGTAGGTGGGTGCTTAAGTCAGGTGTGAAAACTCTGGGCTCAACCTGGAGACTGCACTTGAAACTGGGTATCTTGAGGGCAGGAGAGGAAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
c57bl/60.551724
mouse0.368359
rat0.340426
research facility0.340170
mus musculus0.332623
canada0.313725
male0.310881
age 8 weeks0.271186
rattus0.243902
taconic farms0.238806
sprague dawley0.238095
LOWER IN jackson laboratories0.186047
mouse chow0.165517
feces0.153715
sweden0.150943
female0.148148
rattus norvegicus0.142857
terminal ileum0.136364
colon0.121212
right colon0.120000
israel0.120000
wistar rat0.105263
LOWER IN a/j0.102564
ileum0.101695
LOWER IN balb/c0.097561
charles river laboratories0.097561
czech republic0.095238
south korea0.088889
LOWER IN high fat diet0.088889
china0.079365
caecum0.070175
LOWER IN feces0.061538
LOWER IN trichuris muris0.054054
bank vole0.054054
myodes glareolus0.054054
ukraine0.054054
a/j0.054054
LOWER IN il-1alpha knockout0.054054
age 28 days0.054054
LOWER IN age 21 days0.054054
LOWER IN pre-weaning0.054054
janvier labs0.054054
LOWER IN high sugar diet0.054054
LOWER IN age 18 weeks0.054054
dahl salt-sensitive0.054054
wild type genotype0.054054
harlan sprague dawley0.054054
LOWER IN dnbs induced colitis0.054054
LOWER IN parasitic helminthiasis infectious disease0.052632
LOWER IN diet0.052632
LOWER IN western diet0.052632
post-weaning0.052632
age 6 weeks0.052632
LOWER IN tongue0.052632
LOWER IN colitis0.048780
control diet0.047619
balb/c0.046512
LOWER IN late timepoints0.045455
united kingdom0.045455
c57bl/6j0.044444
japan0.043478
germany0.043478
united states of america0.038647
age0.037037
control0.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.666667
rattus0.833333
sprague dawley0.714286
rat0.666667
wistar rat0.666667
c57bl/60.533333
canada0.500000
LOWER IN jackson laboratories0.500000
LOWER IN trichuris muris0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
a/j0.500000
LOWER IN il-1alpha knockout0.500000
age 28 days0.500000
LOWER IN age 21 days0.500000
LOWER IN pre-weaning0.500000
janvier labs0.500000
LOWER IN high sugar diet0.500000
LOWER IN age 18 weeks0.500000
dahl salt-sensitive0.500000
wild type genotype0.500000
LOWER IN a/j0.500000
harlan sprague dawley0.500000
LOWER IN dnbs induced colitis0.500000
rattus norvegicus0.428571
age 8 weeks0.333333
terminal ileum0.333333
LOWER IN parasitic helminthiasis infectious disease0.333333
LOWER IN balb/c0.333333
charles river laboratories0.333333
LOWER IN diet0.333333
LOWER IN western diet0.333333
post-weaning0.333333
age 6 weeks0.333333
LOWER IN tongue0.333333
mouse chow0.300000
czech republic0.285714
taconic farms0.250000
mouse0.244898
sweden0.222222
mus musculus0.214286
research facility0.206186
right colon0.200000
israel0.200000
south korea0.200000
LOWER IN high fat diet0.200000
LOWER IN colitis0.166667
control diet0.142857
ileum0.125000
balb/c0.125000
female0.117647
LOWER IN late timepoints0.111111
united kingdom0.111111
colon0.105263
c57bl/6j0.100000
japan0.090909
germany0.090909
caecum0.090909
feces0.086124
LOWER IN feces0.066667
china0.054945
age0.052632
united states of america0.021390
control0.015504
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.971429
mus musculus0.742857
mouse0.742857
feces0.714286
c57bl/60.571429
age 8 weeks0.228571
canada0.228571
taconic farms0.228571
rat0.228571
female0.200000
united states of america0.200000
male0.171429
colon0.142857
rattus0.142857
sprague dawley0.142857
china0.142857
LOWER IN jackson laboratories0.114286
sweden0.114286
mouse chow0.114286
ileum0.085714
terminal ileum0.085714
right colon0.085714
israel0.085714
rattus norvegicus0.085714
LOWER IN feces0.057143
control0.057143
LOWER IN balb/c0.057143
south korea0.057143
charles river laboratories0.057143
LOWER IN high fat diet0.057143
caecum0.057143
wistar rat0.057143
czech republic0.057143
LOWER IN a/j0.057143
LOWER IN parasitic helminthiasis infectious disease0.028571
LOWER IN trichuris muris0.028571
LOWER IN late timepoints0.028571
bank vole0.028571
myodes glareolus0.028571
ukraine0.028571
japan0.028571
a/j0.028571
LOWER IN il-1alpha knockout0.028571
LOWER IN diet0.028571
LOWER IN western diet0.028571
age0.028571
age 28 days0.028571
LOWER IN age 21 days0.028571
LOWER IN pre-weaning0.028571
post-weaning0.028571
germany0.028571
c57bl/6j0.028571
janvier labs0.028571
LOWER IN high sugar diet0.028571
LOWER IN age 18 weeks0.028571
age 6 weeks0.028571
dahl salt-sensitive0.028571
control diet0.028571
LOWER IN tongue0.028571
wild type genotype0.028571
united kingdom0.028571
balb/c0.028571
harlan sprague dawley0.028571
LOWER IN dnbs induced colitis0.028571
LOWER IN colitis0.028571
Exp. ID User ID Description Date Region Flag Sequences
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
423amnoncommon bank vole, myodes glareolus, ukraine, feces2018-12-05v4No1 / 187
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754

Problems / suggestions? Please email info AT dbbact DOT org