Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCGTAGGTGGGTGCTTAAGTCAGGTGTGAAAACTCTGGGCTCAACCTGGAGACTGCACTTGAAACTGGGTATCTTGAGGGCAGGAGAGGAAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
c57bl/60.526316
mouse0.375000
canada0.363636
mus musculus0.340611
research facility0.324074
rat0.320000
age 8 weeks0.266667
male0.256410
rattus0.238095
taconic farms0.235294
sprague dawley0.222222
LOWER IN jackson laboratories0.181818
mouse chow0.157895
caecum0.150000
sweden0.142857
feces0.141777
female0.134293
terminal ileum0.133333
rattus norvegicus0.133333
colon0.119760
right colon0.117647
israel0.108108
wistar rat0.102564
LOWER IN a/j0.100000
ileum0.095238
LOWER IN balb/c0.095238
charles river laboratories0.095238
czech republic0.093023
south korea0.086957
LOWER IN high fat diet0.085106
china0.070423
LOWER IN feces0.058824
age 9 months0.052632
LOWER IN trichuris muris0.052632
bank vole0.052632
myodes glareolus0.052632
ukraine0.052632
a/j0.052632
LOWER IN il-1alpha knockout0.052632
age 28 days0.052632
LOWER IN age 21 days0.052632
LOWER IN pre-weaning0.052632
janvier labs0.052632
LOWER IN high sugar diet0.052632
LOWER IN age 18 weeks0.052632
dahl salt-sensitive0.052632
wild type genotype0.052632
harlan sprague dawley0.052632
LOWER IN dnbs induced colitis0.052632
LOWER IN parasitic helminthiasis infectious disease0.051282
LOWER IN diet0.051282
LOWER IN western diet0.051282
post-weaning0.051282
age 6 weeks0.051282
LOWER IN tongue0.051282
cecal content0.048780
LOWER IN colitis0.047619
control diet0.045455
balb/c0.045455
LOWER IN late timepoints0.044444
united kingdom0.044444
c57bl/6j0.043478
japan0.042553
germany0.040816
age0.036364
united states of america0.036269
control0.022599
Fraction of dbbact annotations with this term covered by the query
TermScore
rattus0.833333
caecum0.750000
canada0.666667
wistar rat0.666667
rat0.571429
sprague dawley0.555556
male0.555556
c57bl/60.500000
LOWER IN jackson laboratories0.500000
age 9 months0.500000
LOWER IN trichuris muris0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
a/j0.500000
LOWER IN il-1alpha knockout0.500000
age 28 days0.500000
LOWER IN age 21 days0.500000
LOWER IN pre-weaning0.500000
janvier labs0.500000
LOWER IN high sugar diet0.500000
LOWER IN age 18 weeks0.500000
dahl salt-sensitive0.500000
wild type genotype0.500000
LOWER IN a/j0.500000
harlan sprague dawley0.500000
LOWER IN dnbs induced colitis0.500000
age 8 weeks0.333333
terminal ileum0.333333
LOWER IN parasitic helminthiasis infectious disease0.333333
LOWER IN balb/c0.333333
rattus norvegicus0.333333
charles river laboratories0.333333
LOWER IN diet0.333333
LOWER IN western diet0.333333
post-weaning0.333333
age 6 weeks0.333333
LOWER IN tongue0.333333
czech republic0.285714
mouse chow0.272727
mouse0.250000
taconic farms0.250000
mus musculus0.220339
right colon0.200000
cecal content0.200000
sweden0.200000
south korea0.200000
research facility0.194444
LOWER IN high fat diet0.181818
LOWER IN colitis0.166667
israel0.153846
control diet0.125000
balb/c0.125000
ileum0.111111
LOWER IN late timepoints0.111111
united kingdom0.111111
colon0.105263
female0.102564
c57bl/6j0.100000
japan0.090909
feces0.078947
germany0.076923
LOWER IN feces0.062500
age0.052632
china0.047170
united states of america0.020000
control0.014184
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.972222
mus musculus0.750000
mouse0.750000
feces0.694444
c57bl/60.555556
canada0.250000
age 8 weeks0.222222
taconic farms0.222222
rat0.222222
female0.194444
united states of america0.194444
male0.166667
colon0.138889
rattus0.138889
sprague dawley0.138889
china0.138889
LOWER IN jackson laboratories0.111111
sweden0.111111
mouse chow0.111111
ileum0.083333
terminal ileum0.083333
right colon0.083333
caecum0.083333
israel0.083333
rattus norvegicus0.083333
LOWER IN feces0.055556
control0.055556
LOWER IN balb/c0.055556
south korea0.055556
charles river laboratories0.055556
LOWER IN high fat diet0.055556
wistar rat0.055556
czech republic0.055556
LOWER IN a/j0.055556
age 9 months0.027778
cecal content0.027778
LOWER IN parasitic helminthiasis infectious disease0.027778
LOWER IN trichuris muris0.027778
LOWER IN late timepoints0.027778
bank vole0.027778
myodes glareolus0.027778
ukraine0.027778
japan0.027778
a/j0.027778
LOWER IN il-1alpha knockout0.027778
LOWER IN diet0.027778
LOWER IN western diet0.027778
age0.027778
age 28 days0.027778
LOWER IN age 21 days0.027778
LOWER IN pre-weaning0.027778
post-weaning0.027778
germany0.027778
c57bl/6j0.027778
janvier labs0.027778
LOWER IN high sugar diet0.027778
LOWER IN age 18 weeks0.027778
age 6 weeks0.027778
dahl salt-sensitive0.027778
control diet0.027778
LOWER IN tongue0.027778
wild type genotype0.027778
united kingdom0.027778
balb/c0.027778
harlan sprague dawley0.027778
LOWER IN dnbs induced colitis0.027778
LOWER IN colitis0.027778
Exp. ID User ID Description Date Region Flag Sequences
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
611amnoncommon mouse, mus musculus, canada, research facility, age 9 months, cecal content, caecum2020-04-21v4No1 / 145
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
423amnoncommon bank vole, myodes glareolus, ukraine, feces2018-12-05v4No1 / 187
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754

Problems / suggestions? Please email info AT dbbact DOT org