Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATGCAAGTTGGGTGTCAAAACTACCGGCTCAACCGATAGTCGCACTCAAAACTGCAGCTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
mouse0.744361
mus musculus0.732469
c57bl/60.457627
research facility0.407284
caecum0.284483
c57bl/6j0.256667
age 8 weeks0.226415
canada0.226415
feces0.213133
taconic farms0.204545
female0.194939
united states of america0.186992
high fat diet0.179372
male0.148515
jackson laboratories0.136364
colon0.132597
charles river laboratories0.129032
mouse chow0.123457
terminal ileum0.117647
LOWER IN antibiotic0.117647
diet0.106383
right colon0.105263
LOWER IN jackson laboratories0.102564
balb/c0.102564
ileum0.086957
jackson laboratory0.078947
ldlr -/-0.078947
state of maryland0.078947
LOWER IN mouse chow0.072289
LOWER IN feces0.059701
japan0.058252
LOWER IN c57bl/6j0.054795
ldlr-0.054054
every other day fasting0.054054
preweaned0.054054
age 2-4 weeks0.054054
suckling0.054054
strain 129s0.054054
harlan sprague dawley0.054054
a/j0.054054
LOWER IN ampicillin0.054054
normal diet0.053333
state of washington0.052632
western diet0.052632
jiangxi province0.052632
control0.052356
fasting0.051282
LOWER IN c57bl/60.051282
south korea0.050000
germany0.048193
pig0.045455
sus scrofa0.045455
united kingdom0.045455
age0.044944
sweden0.044444
wild0.038462
china0.037855
farm0.031746
LOWER IN control0.028571
linoleic acid0.027778
cba/j mice0.027778
LOWER IN dextran sulfate sodium0.027778
LOWER IN dss0.027778
cast/eij0.027778
LOWER IN diet induced metabolic disease0.027778
age 24 weeks0.027778
LOWER IN age 3 weeks0.027778
interferon gamma knockout0.027778
obese body mass index status0.027778
db/db mouse0.027778
c3h/hej0.027778
cba/caj0.027778
fvb/n mice0.027778
regular mouse chow0.027778
nod mouse0.027778
LOWER IN cefoperazone0.027778
polga mutant0.027778
state of iowa0.027778
cf-10.027778
age 28 days0.027778
LOWER IN age 21 days0.027778
LOWER IN pre-weaning0.027778
LOWER IN esophagus0.027778
janvier labs0.027778
LOWER IN high sugar diet0.027778
LOWER IN age 18 weeks0.027778
LOWER IN weaned0.027778
LOWER IN corn and soybean diet0.027778
LOWER IN age 4-7 weeks0.027778
house mice0.027778
queens region0.027778
LOWER IN manhatten region0.027778
wild type genotype0.027778
LOWER IN clindamycin0.027778
heavy metal0.027778
LOWER IN stress0.027397
LOWER IN caloric restriction diet0.027397
LOWER IN taconic farms0.027397
low fat diet0.027397
post-weaning0.027397
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum1.500000
c57bl/6j0.700000
LOWER IN c57bl/6j0.666667
charles river laboratories0.666667
mouse0.634615
mus musculus0.593220
c57bl/60.562500
male0.555556
ldlr-0.500000
linoleic acid0.500000
cba/j mice0.500000
LOWER IN dextran sulfate sodium0.500000
LOWER IN dss0.500000
taconic farms0.500000
jackson laboratory0.500000
ldlr -/-0.500000
cast/eij0.500000
LOWER IN diet induced metabolic disease0.500000
age 24 weeks0.500000
LOWER IN age 3 weeks0.500000
interferon gamma knockout0.500000
LOWER IN jackson laboratories0.500000
state of maryland0.500000
every other day fasting0.500000
obese body mass index status0.500000
db/db mouse0.500000
c3h/hej0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
strain 129s0.500000
harlan sprague dawley0.500000
cba/caj0.500000
fvb/n mice0.500000
regular mouse chow0.500000
balb/c0.500000
a/j0.500000
LOWER IN ampicillin0.500000
nod mouse0.500000
LOWER IN cefoperazone0.500000
polga mutant0.500000
state of iowa0.500000
cf-10.500000
age 28 days0.500000
LOWER IN age 21 days0.500000
LOWER IN pre-weaning0.500000
LOWER IN esophagus0.500000
janvier labs0.500000
LOWER IN high sugar diet0.500000
LOWER IN age 18 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
house mice0.500000
queens region0.500000
LOWER IN manhatten region0.500000
wild type genotype0.500000
LOWER IN clindamycin0.500000
heavy metal0.500000
mouse chow0.454545
high fat diet0.416667
normal diet0.400000
state of washington0.333333
age 8 weeks0.333333
canada0.333333
terminal ileum0.333333
western diet0.333333
LOWER IN stress0.333333
jackson laboratories0.333333
jiangxi province0.333333
LOWER IN caloric restriction diet0.333333
LOWER IN taconic farms0.333333
LOWER IN antibiotic0.333333
low fat diet0.333333
post-weaning0.333333
LOWER IN balb/c0.333333
age 6 weeks0.333333
LOWER IN tongue0.333333
research facility0.268519
fasting0.250000
bolivia0.250000
LOWER IN metronidazole0.250000
LOWER IN c57bl/60.250000
texas0.250000
state of texas0.250000
new york city0.250000
LOWER IN mouse chow0.230769
diet0.208333
female0.205128
right colon0.200000
south korea0.200000
gastrointestinal system0.200000
obesity0.166667
switzerland0.166667
colon0.157895
germany0.153846
LOWER IN mouth0.142857
feces0.127193
LOWER IN stomach0.125000
LOWER IN duodenum0.125000
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.957143
mouse0.900000
research facility0.842857
feces0.657143
united states of america0.500000
c57bl/60.385714
female0.185714
age 8 weeks0.171429
canada0.171429
c57bl/6j0.157143
caecum0.157143
taconic farms0.128571
high fat diet0.114286
colon0.114286
control0.100000
male0.085714
jackson laboratories0.085714
diet0.071429
ileum0.071429
terminal ileum0.071429
right colon0.071429
charles river laboratories0.071429
mouse chow0.071429
LOWER IN antibiotic0.071429
LOWER IN feces0.057143
LOWER IN jackson laboratories0.057143
china0.057143
balb/c0.057143
LOWER IN control0.042857
jackson laboratory0.042857
ldlr -/-0.042857
LOWER IN mouse chow0.042857
state of maryland0.042857
japan0.042857
ldlr-0.028571
state of washington0.028571
LOWER IN c57bl/6j0.028571
sweden0.028571
western diet0.028571
age0.028571
fasting0.028571
every other day fasting0.028571
wild0.028571
pig0.028571
sus scrofa0.028571
farm0.028571
jiangxi province0.028571
preweaned0.028571
age 2-4 weeks0.028571
suckling0.028571
normal diet0.028571
strain 129s0.028571
harlan sprague dawley0.028571
germany0.028571
a/j0.028571
LOWER IN c57bl/60.028571
south korea0.028571
LOWER IN ampicillin0.028571
united kingdom0.028571
linoleic acid0.014286
cba/j mice0.014286
LOWER IN dextran sulfate sodium0.014286
LOWER IN dss0.014286
LOWER IN female0.014286
cast/eij0.014286
LOWER IN diet induced metabolic disease0.014286
age 24 weeks0.014286
LOWER IN age 3 weeks0.014286
interferon gamma knockout0.014286
LOWER IN stress0.014286
bolivia0.014286
obese body mass index status0.014286
db/db mouse0.014286
obesity0.014286
c3h/hej0.014286
switzerland0.014286
LOWER IN caloric restriction diet0.014286
LOWER IN taconic farms0.014286
cba/caj0.014286
brazil0.014286
LOWER IN metronidazole0.014286
fvb/n mice0.014286
regular mouse chow0.014286
LOWER IN high fat diet0.014286
texas0.014286
nod mouse0.014286
low fat diet0.014286
LOWER IN cefoperazone0.014286
polga mutant0.014286
state of iowa0.014286
cf-10.014286
age 28 days0.014286
LOWER IN age 21 days0.014286
LOWER IN pre-weaning0.014286
post-weaning0.014286
LOWER IN balb/c0.014286
gastrointestinal system0.014286
rectum0.014286
LOWER IN esophagus0.014286
LOWER IN stomach0.014286
Exp. ID User ID Description Date Region Flag Sequences
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 2
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v4No1 / 37
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 101
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 106
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 119
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 140
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 148
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 181
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 182
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 186
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 190
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 255
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to clindamycin antibiotic in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 394
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658

Problems / suggestions? Please email info AT dbbact DOT org