Search result for sequence:
TACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGTCAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTGATTTTCTTGAGTACTGGAGAGGAAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.258065
rural community0.240000
LOWER IN crohn's disease0.222222
feces0.217273
child0.210526
adult0.144144
hunter gatherer0.142857
chuquisaca department0.142857
age 5-13 years0.133333
bolivia0.125000
control0.100000
cron diet0.100000
kebbi state0.100000
age 10-15 years0.100000
hadza0.100000
LOWER IN age < 1 year0.100000
small village0.100000
ethiopia0.100000
LOWER IN mouth mucosa0.100000
body mass index0.097561
caloric restriction diet0.095238
low bmi0.095238
nigeria0.095238
tanzania0.095238
infant0.095238
kingdom of denmark0.095238
wet season0.095238
LOWER IN dry season0.095238
LOWER IN high bmi0.093023
monkey0.090909
LOWER IN mouth0.080000
colon0.072727
age0.072727
obsolete_juvenile stage0.071429
city0.057143
united states of america0.056338
LOWER IN irritable bowel syndrome0.052632
glasgow0.052632
physical activity0.052632
LOWER IN little physical activity0.052632
urinary schistosomiasis0.052632
schistosomiasis0.052632
age 1-3 years0.052632
nanchang city prefecture0.052632
LOWER IN pancreatitis0.052632
LOWER IN acute pancreatitis0.052632
el salvador0.052632
LOWER IN lima0.052632
LOWER IN shantytown0.052632
africa0.052632
sewage0.052632
influent0.052632
LOWER IN effluent0.052632
sigmoid colon0.052632
children0.052632
tunapuco0.052632
LOWER IN state of oklahoma0.052632
chlorocebus djamdjamensis0.052632
bale monkey0.052632
age one year0.052632
LOWER IN age one month0.052632
LOWER IN arm0.052632
LOWER IN forearm0.052632
harlan sprague dawley0.052632
theropithecus gelada0.052632
forearm0.052632
LOWER IN obsolete_juvenile stage0.051282
age < 3 years0.051282
metabolic syndrome0.051282
LOWER IN american diet0.051282
south america0.051282
venezuela0.051282
amerindian0.051282
terminal ileum0.051282
peru0.051282
arm0.051282
russia0.050000
LOWER IN finland0.050000
wastewater treatment plant0.050000
LOWER IN jackson laboratories0.050000
egypt0.048780
LOWER IN infant0.048780
biopsy0.048780
LOWER IN child0.047619
india0.047619
LOWER IN city0.047619
LOWER IN skin0.047619
LOWER IN ulcerative colitis0.046512
belgium0.046512
kingdom of norway0.045455
ileum0.045455
LOWER IN duodenum0.045455
LOWER IN united states of america0.045455
united kingdom0.044444
rectum0.044444
kingdom of spain0.043478
brazil0.040000
LOWER IN feces0.039216
caecum0.034483
diet0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn's disease0.555556
LOWER IN irritable bowel syndrome0.500000
glasgow0.500000
cron diet0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
hadza0.500000
hunter gatherer0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
el salvador0.500000
small village0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
africa0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
ethiopia0.500000
age one year0.500000
LOWER IN age one month0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
harlan sprague dawley0.500000
LOWER IN mouth mucosa0.500000
theropithecus gelada0.500000
forearm0.500000
rural community0.428571
body mass index0.400000
LOWER IN obsolete_juvenile stage0.333333
caloric restriction diet0.333333
low bmi0.333333
nigeria0.333333
tanzania0.333333
age < 3 years0.333333
kingdom of denmark0.333333
metabolic syndrome0.333333
wet season0.333333
LOWER IN dry season0.333333
LOWER IN american diet0.333333
south america0.333333
venezuela0.333333
amerindian0.333333
terminal ileum0.333333
peru0.333333
age 5-13 years0.333333
arm0.333333
LOWER IN high bmi0.285714
russia0.250000
LOWER IN finland0.250000
wastewater treatment plant0.250000
monkey0.250000
bolivia0.250000
LOWER IN jackson laboratories0.250000
child0.200000
egypt0.200000
LOWER IN infant0.200000
biopsy0.200000
LOWER IN child0.166667
india0.166667
LOWER IN city0.166667
LOWER IN skin0.166667
homo sapiens0.150943
LOWER IN ulcerative colitis0.142857
belgium0.142857
LOWER IN mouth0.142857
kingdom of norway0.125000
ileum0.125000
LOWER IN duodenum0.125000
LOWER IN united states of america0.125000
feces0.123762
infant0.111111
united kingdom0.111111
rectum0.111111
colon0.105263
age0.105263
adult0.101266
kingdom of spain0.100000
obsolete_juvenile stage0.100000
brazil0.071429
LOWER IN feces0.066667
control0.064516
city0.058824
caecum0.045455
diet0.041667
skin0.040000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.888889
feces0.888889
adult0.250000
control0.222222
united states of america0.222222
child0.222222
rural community0.166667
LOWER IN crohn's disease0.138889
hunter gatherer0.083333
infant0.083333
age 5-13 years0.083333
bolivia0.083333
chuquisaca department0.083333
colon0.055556
cron diet0.055556
caloric restriction diet0.055556
body mass index0.055556
low bmi0.055556
LOWER IN high bmi0.055556
nigeria0.055556
kebbi state0.055556
age 10-15 years0.055556
china0.055556
tanzania0.055556
hadza0.055556
age0.055556
LOWER IN age < 1 year0.055556
city0.055556
small village0.055556
kingdom of denmark0.055556
wet season0.055556
LOWER IN dry season0.055556
obsolete_juvenile stage0.055556
monkey0.055556
ethiopia0.055556
LOWER IN mouth mucosa0.055556
LOWER IN mouth0.055556
kingdom of norway0.027778
LOWER IN feces0.027778
ileum0.027778
kingdom of spain0.027778
LOWER IN irritable bowel syndrome0.027778
glasgow0.027778
LOWER IN obsolete_juvenile stage0.027778
LOWER IN child0.027778
physical activity0.027778
LOWER IN little physical activity0.027778
urinary schistosomiasis0.027778
schistosomiasis0.027778
LOWER IN ulcerative colitis0.027778
age 1-3 years0.027778
brazil0.027778
belgium0.027778
nanchang city prefecture0.027778
LOWER IN pancreatitis0.027778
LOWER IN acute pancreatitis0.027778
el salvador0.027778
LOWER IN lima0.027778
LOWER IN shantytown0.027778
age < 3 years0.027778
russia0.027778
LOWER IN finland0.027778
metabolic syndrome0.027778
united kingdom0.027778
LOWER IN american diet0.027778
diet0.027778
africa0.027778
LOWER IN duodenum0.027778
egypt0.027778
south america0.027778
wastewater treatment plant0.027778
sewage0.027778
influent0.027778
LOWER IN effluent0.027778
venezuela0.027778
amerindian0.027778
LOWER IN infant0.027778
india0.027778
rectum0.027778
terminal ileum0.027778
sigmoid colon0.027778
caecum0.027778
biopsy0.027778
children0.027778
peru0.027778
tunapuco0.027778
LOWER IN united states of america0.027778
LOWER IN city0.027778
LOWER IN state of oklahoma0.027778
chlorocebus djamdjamensis0.027778
bale monkey0.027778
age one year0.027778
LOWER IN age one month0.027778
LOWER IN skin0.027778
LOWER IN arm0.027778
LOWER IN forearm0.027778
mus musculus0.027778
mouse0.027778
research facility0.027778
female0.027778
Exp. ID User ID Description Date Region Flag Sequences
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org