Search result for sequence:
TACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATCGCAAGTCAGATGTGAAAACTATGGGCTTAACCCATAAACTGCATTTGAAACTGTGGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.586230
feces0.464759
adult0.442359
united states of america0.188641
child0.184211
china0.156444
control0.153043
city0.137615
rural community0.108317
obsolete_juvenile stage0.104089
LOWER IN crohn's disease0.093897
female0.085784
jiangsu province0.085106
india0.080321
infant0.071685
age0.071048
state of oklahoma0.065041
age 5-13 years0.065041
kingdom of denmark0.062016
kingdom of spain0.061381
small village0.049587
age 50-60 years0.048780
nanning city prefecture0.048780
chuquisaca department0.048780
LOWER IN ulcerative colitis0.048387
biopsy0.048193
sus scrofa0.047619
pig0.047619
kingdom of norway0.046512
bolivia0.046512
duodenum0.045977
water0.036810
age 200.033058
himalayas0.033058
commonwealth of pennsylvania0.033058
nanchang city prefecture0.033058
thailand0.033058
age 60-790.033058
age 30-500.033058
new delhi0.033058
oslo0.033058
age 30-400.033058
age 130.033058
LOWER IN age < 1 year0.033058
africa0.033058
LOWER IN mouth mucosa0.033058
LOWER IN infant0.032787
LOWER IN rural community0.032787
metabolic syndrome0.032520
czech republic0.032520
nepal0.032520
ulcerative colitis0.032258
state of michigan0.032258
finland0.032258
state of arizona0.032000
south korea0.032000
biopsy site0.032000
small intestine0.032000
juvenile organism0.032000
united kingdom0.031746
rectum0.031746
commonwealth of virginia0.031496
river0.031008
belgium0.030534
LOWER IN mouth0.030534
australia0.030303
fresh water0.029630
state of california0.029412
germany0.028777
skin0.028169
native american0.016807
cheyenne0.016807
arapaho0.016807
LOWER IN american0.016807
new york county0.016807
LOWER IN chronic fatigue syndrome0.016807
LOWER IN premature birth0.016807
salmonella gastroenteritis0.016807
LOWER IN insomnia0.016807
tharu0.016807
agrarian0.016807
age 17-290.016807
quito0.016807
LOWER IN nephrolithiasis0.016807
LOWER IN egypt0.016807
raji0.016807
hmong0.016807
azerbaijan0.016807
age 19-240.016807
age 8-120.016807
age one month0.016807
LOWER IN age one week0.016807
LOWER IN inflammatory bowel disease0.016807
age 3-60.016807
mild0.016807
LOWER IN severe0.016807
irritable bowel syndrome0.016807
age >940.016807
gallbladder0.016807
bile0.016807
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
state of oklahoma0.666667
age 5-13 years0.666667
india0.666667
rural community0.571429
LOWER IN crohn's disease0.555556
age 200.500000
native american0.500000
cheyenne0.500000
arapaho0.500000
LOWER IN american0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN premature birth0.500000
salmonella gastroenteritis0.500000
LOWER IN insomnia0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
quito0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
LOWER IN egypt0.500000
raji0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
oslo0.500000
age 30-400.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
glasgow0.500000
el salvador0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
LOWER IN age >940.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
canada0.500000
atherosclerosis0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN thailand0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
africa0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.931624
feces0.871795
adult0.470085
united states of america0.316239
china0.205128
control0.188034
child0.119658
city0.085470
female0.059829
rural community0.059829
obsolete_juvenile stage0.059829
LOWER IN crohn's disease0.051282
jiangsu province0.051282
infant0.042735
age0.042735
india0.042735
state of oklahoma0.034188
kingdom of denmark0.034188
age 5-13 years0.034188
kingdom of spain0.034188
age 50-60 years0.025641
nanning city prefecture0.025641
biopsy0.025641
LOWER IN ulcerative colitis0.025641
duodenum0.025641
kingdom of norway0.025641
small village0.025641
sus scrofa0.025641
pig0.025641
water0.025641
bolivia0.025641
chuquisaca department0.025641
state of arizona0.017094
age 200.017094
metabolic syndrome0.017094
germany0.017094
commonwealth of virginia0.017094
ulcerative colitis0.017094
south korea0.017094
australia0.017094
state of california0.017094
czech republic0.017094
nepal0.017094
himalayas0.017094
commonwealth of pennsylvania0.017094
state of michigan0.017094
nanchang city prefecture0.017094
thailand0.017094
biopsy site0.017094
belgium0.017094
age 60-790.017094
age 30-500.017094
new delhi0.017094
small intestine0.017094
oslo0.017094
age 30-400.017094
LOWER IN control0.017094
age 130.017094
juvenile organism0.017094
finland0.017094
LOWER IN infant0.017094
united kingdom0.017094
LOWER IN rural community0.017094
LOWER IN age < 1 year0.017094
rectum0.017094
river0.017094
fresh water0.017094
africa0.017094
LOWER IN mouth mucosa0.017094
LOWER IN mouth0.017094
skin0.017094
native american0.008547
cheyenne0.008547
arapaho0.008547
LOWER IN american0.008547
new york county0.008547
LOWER IN chronic fatigue syndrome0.008547
vagina0.008547
pregnancy0.008547
LOWER IN premature birth0.008547
LOWER IN systemic lupus erythematosus0.008547
LOWER IN male0.008547
hospital0.008547
salmonella gastroenteritis0.008547
diarrhea0.008547
LOWER IN hiv infection0.008547
LOWER IN insomnia0.008547
tharu0.008547
agrarian0.008547
age 17-290.008547
state of ohio0.008547
ecuador0.008547
quito0.008547
LOWER IN nephrolithiasis0.008547
italy0.008547
high bmi0.008547
obesity0.008547
LOWER IN egypt0.008547
raji0.008547
american diet0.008547
Exp. ID User ID Description Date Region Flag Sequences
276amnonhighfreq feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 47
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org