Search result for sequence:
TACGTAGGGAGCGAGCGTTGTCCGGATTCATTGGGCGTAAAGAGCTCGTAGGCGGCTTGATAAGTCGGATGTGAAACCTCCAGGCTCAACCTGGAGTCGCCATCCGATACTGTCATGGCTAGAGTCCGGTAGGGGCCCACGGAACTCCTG
common ontology terms
term enrichment score
TermScore
soil0.390114
rhizosphere0.247691
forest ecosystem0.212048
minas gerais state0.185567
campos rupestres0.185567
topsoil0.183486
brazil0.176471
depth (soil) 0-10cm0.163488
ph 4-50.140762
woodland area0.140078
zhejiang province0.125984
depth (soil) 0-20cm0.124224
china0.115813
mesocosm0.112360
alabama0.112360
ultisol0.112360
auburn0.106383
park0.094118
vellozia epidendroides0.091954
mature barley plants0.091954
days 1800.091954
quzhou county0.091954
paddy field soil0.087912
hordeum vulgare0.087912
LOWER IN root0.085106
depth (soil) 15cm0.084211
state of georgia0.084034
agricultural field0.071942
bon portage island0.070588
burrow0.070588
ph<50.070588
barbacenia macrantha0.070588
oak0.070588
foot slope 0.070588
ph 50.069364
quercus0.068182
bulk soil0.067039
rock0.065934
cultivated environment0.065934
biochar0.065934
depth (soil) 0-30 cm0.065934
canada0.064935
zea mays0.063830
triticum aestivum0.062827
farm0.062338
cinnamomum camphora0.049383
anxi county0.049383
soybean0.048780
quarry0.048193
duluth complex0.048193
oceanodroma leucorhoa0.048193
seabird0.048193
arachis hypogaea0.048193
peanut0.048193
moist tropical forest0.048193
LOWER IN ph&gt;50.048193
red soil0.048193
copper0.048193
taihu lake0.048193
taihu national park0.048193
acute oak decline0.048193
panax notoginseng0.048193
sanqi plants0.048193
xundian county0.048193
upland soil0.048193
dekalb county0.048193
illinois0.048193
wheat0.047619
peatland0.047059
siberia0.047059
sulfide0.047059
province of quebec0.047059
cambisol0.047059
yunnan province0.047059
depth (soil) 15-30cm0.047059
glycine max0.046512
orchard0.045977
plant disease0.045977
pot expreiment0.045977
citrus0.044944
lake sediment0.044944
ph 60.043956
hunan province0.043011
state of illinois0.042105
state of minnesota0.040404
depth (water) 20-100cm0.040404
united kingdom0.039735
bird0.037383
root0.036697
ph 5-60.035398
research facility0.028653
united states of america0.027529
cuticle0.025000
chitin-based cuticle0.025000
atlantic rainforest0.025000
parque estadual serra do mar-núcleo picinguaba0.025000
odontomachus hastatus0.025000
sao paulo state0.025000
quaternary laterite soil0.025000
cucurbita moschata0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
cinnamomum camphora1.000000
anxi county1.000000
park0.666667
soybean0.666667
temperate grassland biome0.500000
central park0.500000
pinus sibirica0.500000
pine forest0.500000
lichen0.500000
moss0.500000
quarry0.500000
duluth complex0.500000
depth 2.5cm0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN soilwater0.500000
north china plain0.500000
ph>4, ph<50.500000
svalbard archipelago0.500000
permafrost transition layer0.500000
ph 5.40.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
ph<50.500000
LOWER IN ph&gt;50.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
montane forest0.500000
savanna0.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
reunion island0.500000
copper0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
substraat arabidopsis0.500000
lentse potgrond0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
lu'an city prefecture0.500000
flowerpot0.500000
dendrobium officinale0.500000
LOWER IN bulk sediment0.500000
taihu lake0.500000
taihu national park0.500000
depth (sediment) 0cm0.500000
LOWER IN gaster0.500000
tropical moist broadleaf forest biome0.500000
oak0.500000
acute oak decline0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
lower saxony0.500000
sandy soil0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
foot slope 0.500000
LOWER IN depth 50-90cm0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
LOWER IN depth 12-44cm0.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
ph 5.50.500000
forest ecosystem0.444444
Fraction of annotations for the query sequences containing the term
TermScore
soil0.721519
china0.329114
rhizosphere0.240506
brazil0.151899
forest ecosystem0.139241
united states of america0.126582
depth (soil) 0-20cm0.126582
depth (soil) 0-10cm0.126582
topsoil0.126582
woodland area0.113924
minas gerais state0.113924
campos rupestres0.113924
ph 4-50.101266
zhejiang province0.101266
canada0.063291
research facility0.063291
mesocosm0.063291
state of georgia0.063291
alabama0.063291
auburn0.063291
ultisol0.063291
agricultural field0.063291
park0.050633
LOWER IN root0.050633
paddy field soil0.050633
farm0.050633
vellozia epidendroides0.050633
mature barley plants0.050633
days 1800.050633
hordeum vulgare0.050633
depth (soil) 15cm0.050633
quzhou county0.050633
triticum aestivum0.037975
bulk soil0.037975
rock0.037975
bon portage island0.037975
burrow0.037975
ph 50.037975
ph<50.037975
zea mays0.037975
cultivated environment0.037975
barbacenia macrantha0.037975
biochar0.037975
depth (soil) 0-30 cm0.037975
united kingdom0.037975
oak0.037975
quercus0.037975
foot slope 0.037975
peatland0.025316
siberia0.025316
wheat0.025316
quarry0.025316
duluth complex0.025316
state of minnesota0.025316
sulfide0.025316
bird0.025316
oceanodroma leucorhoa0.025316
seabird0.025316
arachis hypogaea0.025316
peanut0.025316
province of quebec0.025316
glycine max0.025316
soybean0.025316
moist tropical forest0.025316
LOWER IN ph&gt;50.025316
hunan province0.025316
red soil0.025316
cambisol0.025316
citrus0.025316
orchard0.025316
copper0.025316
LOWER IN control0.025316
root0.025316
taihu lake0.025316
depth (water) 20-100cm0.025316
taihu national park0.025316
lake sediment0.025316
ph 5-60.025316
disease0.025316
plant disease0.025316
acute oak decline0.025316
panax notoginseng0.025316
sanqi plants0.025316
ph 60.025316
xundian county0.025316
yunnan province0.025316
pot expreiment0.025316
upland soil0.025316
depth (soil) 15-30cm0.025316
dekalb county0.025316
illinois0.025316
state of illinois0.025316
cinnamomum camphora0.025316
anxi county0.025316
peat soil0.012658
sphagnum bog0.012658
temperate grassland biome0.012658
depth 5cm0.012658
wetland area0.012658
urban biome0.012658
Exp. ID User ID Description Date Region Flag Sequences
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
205amnoncommon in rock piles from duluth complex (common rock, united states of america, quarry, duluth complex, ph 4-5, state of minnesota, sulfide)2017-10-03v4No1 / 205
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth (soil) 15cm depth in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 265
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
347amnon high in depth (soil) 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org