Search result for sequence:
TACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.640806
china0.349265
rhizosphere0.290414
united states of america0.187804
triticum aestivum0.139347
agricultural field0.128637
cultivated environment0.123131
skin0.117035
zea mays0.108696
germany0.099344
silt loam0.086687
state of california0.084883
desert0.083436
wheat0.081420
river0.079268
loess plateau0.075000
depth 0-10cm0.073171
depth 0-20cm0.068351
shaanxi province0.067901
leaf0.067393
farm0.067202
bulk soil0.063762
ph 60.063694
israel0.063082
agricultural feature0.060381
glycine max0.059631
fresh water0.059347
ph 7-80.057640
pot expreiment0.057325
state of new york0.055470
ph 7.60.054452
biochar0.054255
oryza sativa0.054157
united states0.053292
des moines0.053292
nicollet soil series0.053292
kalamazoo loam0.053292
mesic type hapludalf0.053292
kellogg biological station0.053292
sediment0.052316
iowa0.051908
root0.049689
water0.049468
brazil0.048135
air0.047885
jiangsu province0.047319
state of michigan0.044914
citrus0.044800
reforestation0.044304
robinia pseudoacacia0.044304
tree0.043818
mexico0.042879
canada0.042879
ph 90.041700
ph 70.041556
zhejiang province0.040988
mississippi river0.038710
orchard0.038585
hordeum vulgare0.038585
topsoil0.036474
winter0.036389
sandy loam soil0.035455
solanum lycopersicum0.035299
north china plain0.035144
depth (soil) 15cm0.035144
grazing exclusion0.035144
haplic calcisol0.035144
calci-orthic aridisol0.035144
ningxia province0.035144
yunwushan national natural grassland protection zone0.035144
greenhouse0.032397
quzhou county0.032051
days 1800.032051
mature barley plants0.032051
lettuce0.032051
sand0.031881
depth 0-5cm0.031797
depth 10 cm0.031797
state of illinois0.031797
kingdom of denmark0.031712
ph 4-50.031546
state of tennessee0.030581
research facility0.029268
snake0.029150
paddy field soil0.029150
clay loam0.029150
ph 6-70.029044
coarse-loamy soil0.028939
flood plain0.028939
sacramento0.028939
cosumnes river preserve0.028939
irrigated0.028939
guanajuato0.028939
bernburg0.028939
crop rotation0.028939
dekalb county0.028939
illinois0.028939
agave0.028939
homo sapiens0.028884
state of idaho0.028526
Fraction of dbbact annotations with this term covered by the query
TermScore
cultivated environment0.875000
ph 7-80.875000
zea mays0.875000
bulk soil0.857143
agricultural field0.857143
ph 60.833333
ph 7.60.833333
triticum aestivum0.818182
soil0.784946
rhizosphere0.772727
wheat0.750000
agricultural feature0.750000
greenhouse soil0.750000
depth 0-30cm0.750000
biochar0.750000
npk fertilizer0.750000
pot expreiment0.750000
conventional tillage0.750000
maize field0.750000
cucumber0.750000
urban biome0.750000
greenhouse0.750000
rice0.750000
mississippi river0.750000
oryza sativa0.714286
hunan province0.714286
silt loam0.666667
orchard0.666667
citrus0.666667
hordeum vulgare0.666667
ph 90.666667
shanxi province0.666667
loess plateau0.666667
ph 7.70.666667
sandy loam soil0.666667
heilongjiang province0.666667
mollisol0.666667
brassica napus0.666667
soybean0.666667
ph 7.850.666667
depth (soil) 30-60cm0.666667
yunnan province0.666667
air0.666667
loam soil0.666667
trichoderma guizhouense njau 47420.666667
ph 7.50.666667
chemical fertilization n,p,k0.666667
newt0.666667
salamandra salamandra0.666667
seed0.666667
brassica oleracea0.666667
anser cygnoides0.666667
cucumis sativus0.666667
building0.666667
snake0.666667
nicotiana tabacum0.666667
arm0.666667
pasture0.666667
manure fertilization0.666667
venezuela0.666667
amerindian0.666667
particles0.666667
LOWER IN hay0.666667
npk fertilization0.666667
fusarium oxysporum0.666667
LOWER IN stem0.666667
low fusarium cumulative disease incidence 0.666667
bio-organic fertilizer0.666667
forested area0.666667
ph 5.60.666667
heavy metal0.666667
ph 7.90.666667
paddy field soil0.666667
park0.666667
clay loam0.666667
cambisol0.666667
depth 10-20cm0.666667
ph 5.90.666667
desert0.625000
depth 5cm0.600000
ph 70.600000
solanum lycopersicum0.571429
glycine max0.571429
ph 6-70.571429
LOWER IN root0.545455
north china plain0.500000
seleniferous0.500000
ph>80.500000
ph>7, ph<80.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
populus0.500000
coarse-loamy soil0.500000
day 820.500000
apennine mountains0.500000
prunus armeniaca0.500000
apricot0.500000
ph>6, ph<70.500000
stover ammendment 0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.541391
china0.346026
united states of america0.243377
rhizosphere0.178808
triticum aestivum0.076159
agricultural field0.069536
skin0.067881
cultivated environment0.066225
zea mays0.057947
germany0.057947
state of california0.049669
silt loam0.046358
desert0.044702
wheat0.043046
river0.043046
loess plateau0.039735
depth 0-10cm0.039735
depth 0-20cm0.038079
farm0.038079
israel0.036424
leaf0.036424
shaanxi province0.036424
ph 60.033113
bulk soil0.033113
fresh water0.033113
agricultural feature0.031457
glycine max0.031457
state of new york0.029801
ph 7-80.029801
pot expreiment0.029801
water0.029801
biochar0.028146
iowa0.028146
united states0.028146
des moines0.028146
nicollet soil series0.028146
ph 7.60.028146
sediment0.028146
oryza sativa0.028146
state of michigan0.028146
kalamazoo loam0.028146
mesic type hapludalf0.028146
kellogg biological station0.028146
root0.026490
adult0.026490
brazil0.026490
air0.024834
jiangsu province0.024834
tree0.023179
citrus0.023179
mexico0.023179
homo sapiens0.023179
canada0.023179
reforestation0.023179
robinia pseudoacacia0.023179
winter0.021523
zhejiang province0.021523
ph 90.021523
ph 70.021523
orchard0.019868
hordeum vulgare0.019868
research facility0.019868
feces0.019868
mississippi river0.019868
topsoil0.019868
north china plain0.018212
depth (soil) 15cm0.018212
solanum lycopersicum0.018212
sandy loam soil0.018212
grazing exclusion0.018212
haplic calcisol0.018212
calci-orthic aridisol0.018212
ningxia province0.018212
yunwushan national natural grassland protection zone0.018212
state of tennessee0.016556
depth 0-5cm0.016556
depth 10 cm0.016556
ph 4-50.016556
quzhou county0.016556
days 1800.016556
mature barley plants0.016556
sand0.016556
kingdom of denmark0.016556
state of illinois0.016556
greenhouse0.016556
lettuce0.016556
coarse-loamy soil0.014901
flood plain0.014901
sacramento0.014901
cosumnes river preserve0.014901
irrigated0.014901
guanajuato0.014901
bernburg0.014901
crop rotation0.014901
dekalb county0.014901
illinois0.014901
frog0.014901
wild0.014901
agave0.014901
snake0.014901
Exp. ID User ID Description Date Region Flag Sequences
155amnonhigh freq in soil loosely bound to wheat root (dominant soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 1
296amnonhigh freq. in wheat field soil (dominant agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 1
76amnonhigh freq. in seleniferous soil (dominant united states of america, soil, rhizosphere, selenium, state of florida, seleniferous)2017-02-28v4No1 / 2
155amnonhigh freq in soil tightly bound to wheat root (dominant soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 2
271amnondominant soil, depth 0-20cm, china2018-01-09v4No1 / 2
296amnondominant agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 3
296amnondominant agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 3
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 3
462amnondominant united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 3
600sheryoDominant in biochar ammended soil after 82 days (dominant united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 3
798amnondominant orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 3
296amnondominant agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 4
415amnondominant orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 4
600sheryoDominant in stover ammended soil after 82 days (dominant united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 4
608sheryoDominant in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (dominant soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 4
296amnondominant agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 5
608sheryoDominant in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (dominant soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments amended with biochar (dominant soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments unamended with biochar (dominant soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in bulk soil with barley plants after 180 days in treatments amended with biochar (dominant soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 5
791sheryoDominant at 80cm depth in low saline low sodicity soil in China (dominant soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 5
765sheryoDominant in wheat field in the loess plateau in china (dominant soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 0-30cm depth (dominant united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 5
146amnondominant united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 6
263amnonhigh freq. in desert soil irrigated daily in lab (dominant research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 6
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 6
414amnondominant agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 6
462amnondominant united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 6
628sheryodominant in bulk soil with barley plants after 180 days in treatments unamended with biochar (dominant soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 6
792amnondominant desert, rhizosphere, depth 0.5m, china, minqin county, sand, haloxylon ammodendron, ph 92021-06-07v4No1 / 6
801sheryoDominant at depth 60-90cm in corn agriculture fields, Iowa USA (dominant soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 6
792amnondominant desert, rhizosphere, depth 0.5m, china, minqin county, sand, nitraria tangutorum, ph 92021-06-07v4No1 / 7
764sheryoDominant in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 7
134amnondominant rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 8
279amnondominant grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 8
792amnondominant desert, soil, depth 0.5m, china, minqin county, sand, ph 92021-06-07v4No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (dominant soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, maize pre-crop, rapeseed pre-crop)2021-04-12v3No1 / 8
829sheryoDominanmt in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 8
271amnondominant rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil inucolated with Fusarium oxysporum f. sp. niveum (dominant rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 9
769sheryodominant in no tillage wheat field in northern israel (dominant soil, bulk soil, triticum aestivum, israel, vertisol, northen israel, no tillage)2021-04-18v4No1 / 9
783sheryodominant in desert soil in mongolia under water addition treatment (dominant soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (dominant soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 9
801sheryoDominant at depth 30-60cm in corn agriculture fields, Iowa USA (dominant soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar, low biochar)2020-04-21v3No1 / 9
752sheryoDominant in soil planted with Panax notoginseng amended with 2% biochar (dominant soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 9
764sheryoDominant in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 9
92amnondominant air, japan2017-03-09v4No1 / 10
534amnondominant river, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 10
746sheryoDominant in saline soil in dafeng, china (dominant jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 10
769sheryoDominant in conventional tillage wheat field in northern israel (dominant soil, bulk soil, triticum aestivum, israel, vertisol, conventional tillage, northen israel)2021-04-18v4No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw, high biochar)2020-04-21v3No1 / 10
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-22v3No1 / 10
146amnondominant united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 11
279amnondominant grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 11
783sheryodominant in desert soil in mongolia without water addition treatment (dominant soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 11
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 11
829sheryoDominant in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 11
206amnonhigh freq. in dust storm air from israel particles <10um size (dominant air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 12
370amnoncommon desert, air, gobi desert2018-09-06v4No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 12
752sheryoDominant in soil planted with Panax notoginseng (dominant soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 13
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 13
402amnondominant mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 14
746sheryoDominant in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (dominant solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 14
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 14
126amnondominant rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 15
492amnondominant skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 16
534amnondominant river, tributary, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 16
534amnondominant river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 16
565amnondominant zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 16
492amnondominant skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 17
746sheryoDominant in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (dominant solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 18
59amnoncommon digestive system, centris atripes2017-02-03v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
377amnondominant skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 21
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 23
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 24
375amnoncommon in oil contaminated desert soil (dominant desert, soil, oil contaminated soil, kuwait)2018-09-09v4No1 / 25
460amnonlower in occupied indoor air compared to outdoor air ( high in outdoor compared to indoor office in united states of america air state of california )2019-01-12v4No1 / 25
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
492amnoncommon skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 30
582amnoncommon united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 30
492amnoncommon skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 31
37amnoncommon leaf, solanum lycopersicum, maryland county2016-12-09v4No1 / 33
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
492amnoncommon skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 34
709sheryoHigher in potting mix soil mixed with Murashige and Skoog (MS) medium and not inoculated with Verticillium dahliae ( high in not inoculated with verticillium dahliae compared to inoculated with verticillium dahliae in soil kingdom of the netherlands potting mix lentse potgrond substraat arabidopsis murashige and skoog (ms) medium )2028-05-16v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica oleracea brassica china )2017-07-27v4No1 / 38
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf endosphere2018-08-20v4No1 / 48
662amnoncommon in cucumber surface (common surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 49
462amnoncommon united states of america, state of tennessee, populus, tree, cultivated environment, root2019-01-13v4No1 / 51
279amnon high in mouth compared to stomach small intestine in ochotonidae pika china 2018-01-24v4No1 / 53
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
281amnoncommon cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 63
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
403amnon high in summer compared to winter in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 67
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
99amnoncommon united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 74
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
759amnon high in canis lupus wolf wildlife sactuary compared to canis lupus familiaris dog in feces united states of america state of minnesota 2021-04-06v4No1 / 78
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
279amnoncommon grassland, steppe, leaf, stem, mongolia, china2018-01-24v4No1 / 83
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york depth 0-5cm ph 6 biochar coarse-loamy soil )2020-03-27v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
662amnoncommon water, drinking water, tap water, israel2020-09-20v3No1 / 89
662amnon high in drinking water tap water compared to wastewater treatment plant treated wastewater in water israel 2020-09-20v3No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
769sheryoHigh in conventional tillage compared to no tillage in wheat field in northern israel ( high in conventional tillage compared to no tillage in soil bulk soil triticum aestivum israel vertisol northen israel )2021-04-18v4No1 / 91
582amnoncommon united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 92
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 95
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
360amnon high in spring compared to summer in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
536amnoncommon united states of america, skin, snake, crotalus horridus, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
361amnoncommon leaf, austria, plant, greenhouse, malvaviscus penduliflorus2018-08-21v4No1 / 102
279amnoncommon ochotonidae, pika, mouth, china2018-01-24v4No1 / 103
279amnoncommon grassland, leaf, stem, tibetan plateau, kobresia humilis, china2018-01-24v4No1 / 104
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 4-4.5 "crystal bog" lake 2028-05-23v4No1 / 104
582amnon high in external acoustic meatus ear canal compared to lip labial commissure in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 105
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 112
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne menthol box cigar)2021-03-28v3No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
582amnoncommon united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 124
426amnon high in sand compared to mature soil in tundra permafrost soil russia nenets autonomous okrug 2018-12-08v4No1 / 125
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets original cigar)2021-03-28v3No1 / 127
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne full flavor cigar)2021-03-28v3No1 / 128
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
417amnon high in winter china compared to mongolia summer in feces anser cygnoides bird swan goose 2018-12-01v4No1 / 132
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
628sheryoHigher in bulk soil with barley plants after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in soil bulk soil hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 140
615amnoncommon leaf, brazil, leaf surface, greenhouse, exosphere, campinas, saccharum, sugarcane2020-04-27v4No1 / 143
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
361amnoncommon leaf, austria, plant, greenhouse, howea forsteriana2018-08-21v4No1 / 154
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets sweet cherry cigar)2021-03-28v3No1 / 154
361amnoncommon leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 155
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 159
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 173
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in zea mays maize pre-crop compared to brassica napus rapeseed pre-crop in soil triticum aestivum germany ph 7.6 bernburg loess chernozem conventional tillage mouldboard plough crop rotation )2021-04-12v3No1 / 173
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 176
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manured soil manure fertilization organic fertilization compared to npk fertilization mineral fertilization in soil bulk soil germany thyrow pot expreiment albic luvisol ph 6.4 lettuce )2021-04-07v3No1 / 176
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
534amnoncommon river, tributary, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 196
515amnoncommon river, poland, whole body, beetle, bembidion decorum, carnivorous beetle, raba river2019-04-18v4No1 / 198
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in desert soil oil contaminated soil kuwait )2018-09-09v4No1 / 200
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, upstream, depth 1m, filtered 2.7um, uppper mississippi river2019-01-07v4No1 / 201
224amnoncommon united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 204
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in soil rhizosphere hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 243
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 252
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 256
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 257
309amnon high in other plants compared to geranium pratense meadow geranium in rhizosphere germany 2018-04-05v4No1 / 267
361amnoncommon leaf, austria, plant, greenhouse, chlorophytum comosum2018-08-21v4No1 / 270
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 282
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 287
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
156amnoncommon leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 299
786sheryoHigher at 60-100cm depth compared to 133-166cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 133-166cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 300
665amnoncommon united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 301
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion punctulatum2019-04-18v4No1 / 305
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 305
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, nepal, depth 10 cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
792amnoncommon desert, rhizosphere, depth 0.5m, china, minqin county, sand, nitraria tangutorum, ph 92021-06-07v4No1 / 352
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common soil, rhizosphere, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, lettuce, mineral fertilization)2021-04-08v3No1 / 353
309amnon high in other plants compared to onobrychis viciifolia common sainfoin in rhizosphere germany 2018-04-05v4No1 / 355
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, lettuce, organic fertilization)2021-04-08v3No1 / 359
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in pig manure compost soil paenibacillus low fusarium cumulative disease incidence bio-organic fertilizer conventional tillage paenibacillus polymyxa soil fumigation dazomet deep plough compared to control high fusarium cumulative disease incidence in soil china nanjing county chrysanthemum chrysanthemum morifolium ramat. ph 6.9 )2021-04-18v4No1 / 360
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth 60-90cm compared to depth 0-15cm in soil zea mays iowa agricultural field united states des moines nicollet soil series kanawha )2021-06-15v4No1 / 369
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in sand epipsammic compared to rock epilithic in river sediment biofilm kingdom of spain )2017-11-22v4No1 / 374
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
512amnon high in tibetan plateau riganqiao peatland ph 5.5-6.5 compared to baekdudaegan ph 5-6 hani peatland in peatland fen soil peat soil china 2019-03-22v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
206amnonhigher in dust storm compared to clear days in israel air ( high in dust storm compared to clear day in air dust israel size < 10um )2017-10-04v4No1 / 411
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 431
360amnoncommon desert, soil, rhizosphere, state of california, agave, agave deserti2018-08-21v4No1 / 432
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth 0.5m china minqin county sand ph 9 2021-06-07v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 442
792amnoncommon desert, rhizosphere, depth 0.5m, china, minqin county, sand, haloxylon ammodendron, ph 92021-06-07v4No1 / 443
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
298amnonhigher in non-mature soil crust ( high in non mature crust compared to mature crust in united states of america desert soil state of utah depth 1cm soil crust )2018-02-20v4No1 / 480
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 481
512amnoncommon peatland, fen, soil, peat soil, tibetan plateau, riganqiao peatland, ph 5.5-6.5, china2019-03-22v4No1 / 483
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-21v3No1 / 489
375amnoncommon in oil contaminated desert soil (common desert, soil, oil contaminated soil, kuwait)2018-09-09v4No1 / 490
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
373amnoncommon rice field, soil, rhizosphere, oryza sativa, hunan province, rice, china2018-09-08v4No1 / 501
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
665amnoncommon united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 526
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
98amnoncommon rhizosphere, state of florida, citrus, immokalee, fl, root2017-04-01v4No1 / 543
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
309amnon high in other plants compared to prunella vulgaris woundwort in rhizosphere germany 2018-04-05v4No1 / 550
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 558
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
357amnoncommon soil, mediterranean forest biome, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 564
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil day 82 )2020-03-27v4No1 / 567
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, downstream, depth 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 568
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in soil switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 577
792amnoncommon desert, soil, depth 0.5m, china, minqin county, sand, ph 92021-06-07v4No1 / 595
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth 15-30cm, kanawha)2021-06-15v4No1 / 598
415amnoncommon orchard, soil, rhizosphere, south africa, citrus, cultivated environment2018-11-27v4No1 / 600
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 609
357amnoncommon savanna, soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 614
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 648
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.7, nicollet soil series, depth 60-90cm)2021-06-15v4No1 / 650
507amnoncommon lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 8-10cm2019-03-17v4No1 / 651
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 7.9, nicollet soil series, depth 60-90cm, kelley, subsurface drainage)2021-06-16v4No1 / 667
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 671
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth 0cm in soil low salinity china songnen plain da'an station salic solonetz low sodicity ph 9 )2021-06-08v4No1 / 675
357amnoncommon in temperate deciduous forests around the world (common soil, temperate woodland biome, topsoil, depth 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 692
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 698
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 701
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 biological fertilization chicken manure compared to chemical fertilization n,p,k in solanum lycopersicum jiangsu province solonchak china dafeng city saline soil ph 7.5 )2021-03-03v4No1 / 703
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
758amnon high in swisher sweets original cigar swisher sweets sweet cherry cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 710
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
357amnon high in ph>3 compared to ph<3 in soil subpolar coniferous forest biome topsoil depth 0-10cm boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 728
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
134amnon high in temperate taxus media taxus cuspidata northeast china compared to subtropical taxus mairei southeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 734
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 737
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond fishpond water fresh water compared to intestine ictalurus punctatus fish channel catfish in united states of america research facility state of alabama )2019-02-12v4No1 / 741
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 751
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common soil, kingdom of the netherlands, potting mix, lentse potgrond, substraat arabidopsis)2028-05-16v4No1 / 752
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, ph 6.7, depth (soil) 30-60cm, nicollet soil series, kelley, subsurface drainage)2021-06-15v4No1 / 760
357amnon high in ph>4 compared to ph<4 in soil topsoil depth 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 761
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, nicollet soil series, depth 60-90cm, kanawha, ph 8.3)2021-06-15v4No1 / 764
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
662amnon high in dry compared to irrigated in soil israel depth 0-10cm agricultural field neve yaar 2020-09-21v3No1 / 782
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
347amnon high in depth (soil) 20-30cm compared to depth 0-20cm permafrost transition layer in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 788
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 798
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth 0-10cm compared to depth 10-20cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 807
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 811
480amnoncommon farm, pasture, soil, ireland2019-02-05v4No1 / 816
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
583amnoncommon mountain, soil, switzerland, depth 0-10cm, ph 7-8, canton of graubunden, elevation 2000-3000m, calcareous parent material2020-01-28v3No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 831
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
265amnoncommon water, canada, province of quebec, soilwater2017-12-11v4No1 / 841
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
698amnoncommon park, rhizosphere, disease, ph 5-6, depth 0-30cm, united kingdom, quercus, oak, acute oak decline, plant disease2028-04-01v3No1 / 848
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, conventional tillage, northen israel)2021-04-18v4No1 / 861
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
769sheryocommon in no tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, northen israel, no tillage)2021-04-18v4No1 / 871
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in low salinity low sodicity ph 9 compared to high salinity high sodicity ph 10 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 895
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth 15-30cm, ph 7.4)2021-06-15v4No1 / 905
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
615amnon high in rhizosphere compared to endosphere root in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 913
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 922
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in low salinity low sodicity ph 8.5 compared to high salinity high sodicity ph 10.5 in soil depth 0cm china songnen plain da'an station salic solonetz )2021-06-08v4No1 / 932
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 166-200cm)2021-05-18v3No1 / 936
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
98amnoncommon rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
414amnon high in ph<6 npk fertilizer compared to ph>6 in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 963
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
480amnoncommon farm, pasture, soil, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 993
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 1001
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
412amnon high in ph>5 compared to ph<5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 1005
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1023
266amnoncommon in soil from PAR garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
768sheryoCommon in maize fields in Brittany, France (common soil, cambisol, zea mays, french republic, maize field, bretagne region)2021-04-18v3No1 / 1034
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
618amnon high in early flowering stage compared to late flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 1040
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
263amnoncommon in desert soil irrigated daily in lab (common research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 1076
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 1080
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 1087
265amnoncommon soil, canada, province of quebec2017-12-11v4No1 / 1090
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
266amnoncommon in roots in MAH garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1110
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1113
698amnoncommon control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak2028-04-01v3No1 / 1115
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 1128
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1136
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 1155
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1209
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
204amnoncommon drinking water reservoir, sediment, water, china2017-10-02v4No1 / 1220
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 100-300cm)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
423amnon high in no human contact chernobyl exclusion zone compared to human contact in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 1229
798amnoncommon orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 1230
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
800amnoncommon 7-18 days following heavy metal contamination (common lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 1248
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
298amnoncommon united states of america, desert, soil, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 1274
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 1282
798amnon high in soil ph 7-8 compared to hay plant litter litter bag in orchard italy depth 10 cm apennine mountains prunus armeniaca apricot 2021-06-13v3No1 / 1285
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
309amnoncommon rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 1296
266amnonCommon in soil from MAH garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1299
223amnoncommon ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 1311
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, biochar, coarse-loamy soil, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 1369
98amnoncommon rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 1397
266amnoncoomon in roots in SIL garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1399
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth 1m filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 1491
631sheryoCommon in maize field biochar amended rhizosphere soil (common soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 1506
309amnoncommon rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 1510
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
154amnon high in control compared to uranium high uranium in sediment soil australia kakadu national park 2017-06-29v4No1 / 1663
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 1714
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
722amnon high in sediment marine sediment sediment surface compared to surface water sea water in united states of america estuary state of new york new york city 2021-01-02v4No1 / 1736
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
536amnon high in aquatic snake compared to terrestrial snake in united states of america skin snake southern united states 2019-07-28v4No1 / 1772
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to summer autumn in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 1962
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>6, ph<7, china2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth 1m 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 20 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 30 years in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 10 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2994
618amnon high in rhizosphere compared to root endosphere root in farm canada cannabis sativa 2020-05-04v4No1 / 3134
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3368
296amnoncommon agricultural feature, soil, winter, wheat, depth 0-20cm, north china plain, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org