Search result for sequence:
TACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTGTGCAGTGGGTACGGGCAGACTTGAGTGCAGTAGGGGAGACTGGAACTCCTGG
common ontology terms
term enrichment score
TermScore
skin0.353211
venezuela0.327869
amerindian0.327869
hunter gatherer0.303030
arm0.275862
air0.212389
canada0.160000
hong kong0.148148
chuquisaca department0.148148
forearm0.148148
tanzania0.137931
dense settlement biome0.137931
age 5-13 years0.137931
LOWER IN mouth0.133333
bolivia0.129032
breast milk0.121212
hospital0.114286
child0.113208
rural community0.108108
LOWER IN feces0.105263
pet0.080000
serinus canaria0.080000
canary0.080000
beach0.080000
aerosol0.080000
subway0.080000
african lion safari0.080000
barbary sheep0.080000
ammotragus lervia0.080000
lapland0.080000
theropithecus gelada0.080000
pseudacris crucifer0.080000
peeper0.080000
africa0.080000
size < 10um0.080000
clear day0.080000
LOWER IN oral cavity0.080000
maryland county0.080000
LOWER IN solanum lycopersicum0.080000
southern united states0.080000
aquatic snake0.080000
LOWER IN terrestrial snake0.080000
depth 0-5cm0.076923
dust0.076923
LOWER IN mouth mucosa0.076923
snake0.076923
snow0.074074
ethiopia0.074074
inguinal region0.074074
horse0.074074
mexico0.071429
commonwealth of virginia0.071429
equus caballus0.071429
city0.070175
captive0.068966
dry season0.068966
LOWER IN wet season0.068966
mucus0.068966
LOWER IN city0.068966
bird0.066667
LOWER IN sea water0.066667
finland0.066667
zoological garden0.064516
kingdom of norway0.064516
monkey0.064516
LOWER IN united states of america0.064516
sweden0.062500
duodenum0.062500
nasal cavity0.062500
LOWER IN saliva0.062500
israel0.060606
pair of nares0.060606
LOWER IN water0.058824
homo sapiens0.056022
canis lupus familiaris0.051282
pacific ocean0.050000
state of california0.047619
leaf0.047619
farm0.043478
united states of america0.038095
feces0.017241
research facility0.016667
control0.013158
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
arm0.666667
venezuela0.666667
amerindian0.666667
hunter gatherer0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
beach0.500000
aerosol0.500000
hong kong0.500000
subway0.500000
african lion safari0.500000
barbary sheep0.500000
ammotragus lervia0.500000
lapland0.500000
theropithecus gelada0.500000
pseudacris crucifer0.500000
peeper0.500000
africa0.500000
size < 10um0.500000
clear day0.500000
LOWER IN oral cavity0.500000
chuquisaca department0.500000
forearm0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
tanzania0.333333
dense settlement biome0.333333
depth 0-5cm0.333333
dust0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
snake0.333333
LOWER IN mouth0.285714
skin0.280000
air0.272727
snow0.250000
ethiopia0.250000
inguinal region0.250000
horse0.250000
bolivia0.250000
breast milk0.200000
mexico0.200000
commonwealth of virginia0.200000
equus caballus0.200000
hospital0.166667
captive0.166667
dry season0.166667
LOWER IN wet season0.166667
mucus0.166667
LOWER IN city0.166667
bird0.142857
LOWER IN sea water0.142857
finland0.142857
rural community0.142857
LOWER IN feces0.133333
zoological garden0.125000
kingdom of norway0.125000
monkey0.125000
LOWER IN united states of america0.125000
sweden0.111111
duodenum0.111111
nasal cavity0.111111
LOWER IN saliva0.111111
child0.100000
israel0.100000
pair of nares0.100000
LOWER IN water0.090909
canis lupus familiaris0.062500
pacific ocean0.058824
city0.058824
state of california0.052632
leaf0.052632
farm0.043478
homo sapiens0.029940
united states of america0.021390
research facility0.010309
feces0.009569
control0.007752
Fraction of annotations for the query sequences containing the term
TermScore
skin0.478261
homo sapiens0.434783
venezuela0.217391
amerindian0.217391
hunter gatherer0.217391
arm0.173913
united states of america0.173913
air0.173913
child0.130435
tanzania0.086957
dense settlement biome0.086957
hospital0.086957
breast milk0.086957
feces0.086957
hong kong0.086957
city0.086957
canada0.086957
LOWER IN feces0.086957
LOWER IN mouth0.086957
age 5-13 years0.086957
bolivia0.086957
rural community0.086957
chuquisaca department0.086957
forearm0.086957
bird0.043478
mexico0.043478
pet0.043478
serinus canaria0.043478
canary0.043478
state of california0.043478
beach0.043478
pacific ocean0.043478
aerosol0.043478
LOWER IN sea water0.043478
LOWER IN water0.043478
subway0.043478
african lion safari0.043478
captive0.043478
zoological garden0.043478
barbary sheep0.043478
ammotragus lervia0.043478
snow0.043478
depth 0-5cm0.043478
lapland0.043478
finland0.043478
sweden0.043478
kingdom of norway0.043478
monkey0.043478
theropithecus gelada0.043478
ethiopia0.043478
dry season0.043478
LOWER IN wet season0.043478
canis lupus familiaris0.043478
research facility0.043478
inguinal region0.043478
commonwealth of virginia0.043478
mucus0.043478
pseudacris crucifer0.043478
peeper0.043478
africa0.043478
duodenum0.043478
dust0.043478
israel0.043478
size < 10um0.043478
clear day0.043478
equus caballus0.043478
horse0.043478
farm0.043478
pair of nares0.043478
nasal cavity0.043478
LOWER IN oral cavity0.043478
LOWER IN saliva0.043478
LOWER IN city0.043478
LOWER IN united states of america0.043478
maryland county0.043478
leaf0.043478
control0.043478
LOWER IN solanum lycopersicum0.043478
LOWER IN mouth mucosa0.043478
snake0.043478
southern united states0.043478
aquatic snake0.043478
LOWER IN terrestrial snake0.043478
Exp. ID User ID Description Date Region Flag Sequences
75amnonhighfreq homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
35amnonhighfreq tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to sea water water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 77
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
565amnoncommon african lion safari, captive, zoological garden, barbary sheep, ammotragus lervia, canada, skin2019-11-21v3No1 / 205
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772

Problems / suggestions? Please email info AT dbbact DOT org