Search result for sequence:
TACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTGTGCAGTGGGTACGGGCAGACTTGAGTGCAGTAGGGGAGACTGGAACTCCTGG
common ontology terms
term enrichment score
TermScore
skin0.336245
venezuela0.327869
amerindian0.327869
hunter gatherer0.303030
arm0.275862
air0.212389
canada0.153846
hong kong0.148148
chuquisaca department0.148148
forearm0.148148
tanzania0.137931
dense settlement biome0.137931
age 5-13 years0.137931
LOWER IN mouth0.133333
bolivia0.129032
breast milk0.121212
hospital0.114286
child0.104348
LOWER IN feces0.102564
rural community0.097561
pet0.080000
serinus canaria0.080000
canary0.080000
beach0.080000
aerosol0.080000
subway0.080000
ammotragus lervia0.080000
barbary sheep0.080000
african lion safari0.080000
lapland0.080000
theropithecus gelada0.080000
pseudacris crucifer0.080000
peeper0.080000
size < 10um0.080000
clear day0.080000
LOWER IN oral cavity0.080000
maryland county0.080000
LOWER IN solanum lycopersicum0.080000
southern united states0.080000
aquatic snake0.080000
LOWER IN terrestrial snake0.080000
africa0.076923
dust0.076923
LOWER IN mouth mucosa0.076923
snake0.076923
snow0.074074
depth 0-5cm0.074074
ethiopia0.074074
inguinal region0.074074
mexico0.071429
commonwealth of virginia0.071429
dry season0.068966
LOWER IN wet season0.068966
mucus0.068966
horse0.068966
city0.067797
LOWER IN sea water0.066667
finland0.066667
equus caballus0.066667
LOWER IN city0.066667
bird0.064516
captive0.064516
kingdom of norway0.064516
monkey0.064516
duodenum0.062500
nasal cavity0.062500
LOWER IN saliva0.062500
LOWER IN united states of america0.062500
zoological garden0.060606
sweden0.060606
LOWER IN water0.058824
pair of nares0.058824
israel0.055556
homo sapiens0.051948
canis lupus familiaris0.051282
pacific ocean0.050000
state of california0.047619
leaf0.046512
farm0.039216
united states of america0.035874
feces0.015936
research facility0.015267
control0.012195
Fraction of dbbact annotations with this term covered by the query
TermScore
arm0.666667
venezuela0.666667
amerindian0.666667
canada0.666667
hunter gatherer0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
beach0.500000
aerosol0.500000
hong kong0.500000
subway0.500000
ammotragus lervia0.500000
barbary sheep0.500000
african lion safari0.500000
lapland0.500000
theropithecus gelada0.500000
pseudacris crucifer0.500000
peeper0.500000
size < 10um0.500000
clear day0.500000
LOWER IN oral cavity0.500000
chuquisaca department0.500000
forearm0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
tanzania0.333333
dense settlement biome0.333333
africa0.333333
dust0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
snake0.333333
LOWER IN mouth0.285714
air0.272727
skin0.259259
snow0.250000
depth 0-5cm0.250000
ethiopia0.250000
inguinal region0.250000
bolivia0.250000
breast milk0.200000
mexico0.200000
commonwealth of virginia0.200000
hospital0.166667
dry season0.166667
LOWER IN wet season0.166667
mucus0.166667
horse0.166667
LOWER IN sea water0.142857
finland0.142857
equus caballus0.142857
LOWER IN city0.142857
bird0.125000
captive0.125000
kingdom of norway0.125000
monkey0.125000
LOWER IN feces0.125000
duodenum0.111111
nasal cavity0.111111
LOWER IN saliva0.111111
rural community0.111111
LOWER IN united states of america0.111111
zoological garden0.100000
sweden0.100000
LOWER IN water0.090909
pair of nares0.090909
child0.086957
israel0.076923
canis lupus familiaris0.062500
pacific ocean0.058824
city0.055556
state of california0.052632
leaf0.050000
farm0.035714
homo sapiens0.027624
united states of america0.020000
research facility0.009259
feces0.008772
control0.007092
Fraction of annotations for the query sequences containing the term
TermScore
skin0.478261
homo sapiens0.434783
venezuela0.217391
amerindian0.217391
hunter gatherer0.217391
arm0.173913
united states of america0.173913
air0.173913
child0.130435
tanzania0.086957
dense settlement biome0.086957
hospital0.086957
breast milk0.086957
feces0.086957
hong kong0.086957
city0.086957
canada0.086957
LOWER IN feces0.086957
LOWER IN mouth0.086957
age 5-13 years0.086957
bolivia0.086957
rural community0.086957
chuquisaca department0.086957
forearm0.086957
bird0.043478
mexico0.043478
pet0.043478
serinus canaria0.043478
canary0.043478
state of california0.043478
beach0.043478
pacific ocean0.043478
aerosol0.043478
LOWER IN sea water0.043478
LOWER IN water0.043478
subway0.043478
ammotragus lervia0.043478
barbary sheep0.043478
zoological garden0.043478
captive0.043478
african lion safari0.043478
snow0.043478
depth 0-5cm0.043478
lapland0.043478
finland0.043478
sweden0.043478
kingdom of norway0.043478
monkey0.043478
theropithecus gelada0.043478
ethiopia0.043478
dry season0.043478
LOWER IN wet season0.043478
canis lupus familiaris0.043478
research facility0.043478
inguinal region0.043478
commonwealth of virginia0.043478
mucus0.043478
pseudacris crucifer0.043478
peeper0.043478
africa0.043478
duodenum0.043478
dust0.043478
israel0.043478
size < 10um0.043478
clear day0.043478
equus caballus0.043478
horse0.043478
farm0.043478
pair of nares0.043478
nasal cavity0.043478
LOWER IN oral cavity0.043478
LOWER IN saliva0.043478
LOWER IN city0.043478
LOWER IN united states of america0.043478
maryland county0.043478
leaf0.043478
control0.043478
LOWER IN solanum lycopersicum0.043478
LOWER IN mouth mucosa0.043478
snake0.043478
southern united states0.043478
aquatic snake0.043478
LOWER IN terrestrial snake0.043478
Exp. ID User ID Description Date Region Flag Sequences
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to sea water water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 77
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772

Problems / suggestions? Please email info AT dbbact DOT org