Search result for sequence:
TACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTTGCGTCTGCTGTGAAATCCCGGGGCTTAACCCCGGGCGTGCAGTGGATACGGGCCGGCTGGAGGCAGGCAGGGGAGAATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
kellogg biological station0.275862
mesic type hapludalf0.275862
kalamazoo loam0.275862
soil0.221191
ph 4-50.193548
mature barley plants0.192308
days 1800.192308
quzhou county0.192308
depth (soil) 0-10cm0.176471
hordeum vulgare0.175439
depth (soil) 25-50cm0.175439
park0.166667
depth (soil) 15cm0.161290
rhizosphere0.160000
panicum virgatum0.160000
bulk soil0.142857
state of michigan0.131148
depth (soil) 10-25cm0.129032
minas gerais state0.125000
campos rupestres0.125000
depth 50-100m0.125000
restored prairie0.125000
oak0.125000
alabama0.125000
upland soil0.125000
ultisol0.125000
corn0.117647
quercus0.117647
auburn0.117647
depth (soil) 0-30 cm0.111111
zhejiang province0.098039
depth (soil) 0-20cm0.096774
topsoil0.086957
forest ecosystem0.086957
bon portage island0.086957
burrow0.086957
barbacenia macrantha0.086957
continuous corn0.086957
miscanthus0.086957
elevation 2000-3000m0.086957
siliceous parent material0.086957
lower saxony0.086957
sandy soil0.086957
dekalb county0.086957
illinois0.086957
province of quebec0.083333
mountain0.083333
woodland area0.080000
ph 4-4.50.080000
maize field0.080000
canada0.078431
london0.076923
ph 50.076923
agricultural field0.076923
biochar0.068966
state of illinois0.068966
switzerland0.066667
brazil0.060606
united kingdom0.052632
volcan sumaco0.046512
cinnamomum camphora0.046512
anxi county0.046512
temperate grassland biome0.045455
central park0.045455
ph<5.50.045455
LOWER IN ph&gt;5.50.045455
oceanodroma leucorhoa0.045455
seabird0.045455
LOWER IN seabird0.045455
LOWER IN oceanodroma leucorhoa0.045455
LOWER IN soilwater0.045455
temperate woodland biome0.045455
temperate deciduos forest0.045455
subpolar coniferous forest biome0.045455
boreal forest0.045455
southern temperate forest0.045455
temperate broadleaf and mixed forest biome0.045455
LOWER IN amended with biochar0.045455
unamended with biochar0.045455
rhone river valley0.045455
ph 4.5-70.045455
canton of graubunden0.045455
acute oak decline0.045455
depth 56-116cm0.045455
depth 108-140cm0.045455
hapludalf0.045455
alfisol0.045455
stratovolcano0.045455
sphagnum bog0.044444
LOWER IN soybean0.044444
soybean0.044444
unamended0.044444
potting mix0.044444
LOWER IN depth (soil) 10-25cm0.044444
ph 4-60.044444
LOWER IN depth (soil) 25-50cm0.044444
mollisol0.044444
sandy loam0.044444
sandy loam soil0.044444
peat soil0.043478
Fraction of dbbact annotations with this term covered by the query
TermScore
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
park0.666667
depth (soil) 10-25cm0.666667
temperate grassland biome0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
LOWER IN soilwater0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
LOWER IN amended with biochar0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
unamended with biochar0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
depth 50-100m0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
oak0.500000
acute oak decline0.500000
lower saxony0.500000
sandy soil0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
depth 56-116cm0.500000
dekalb county0.500000
illinois0.500000
depth 108-140cm0.500000
hapludalf0.500000
alfisol0.500000
stratovolcano0.500000
sphagnum bog0.333333
province of quebec0.333333
LOWER IN soybean0.333333
soybean0.333333
unamended0.333333
potting mix0.333333
hordeum vulgare0.333333
depth (soil) 25-50cm0.333333
corn0.333333
LOWER IN depth (soil) 10-25cm0.333333
mountain0.333333
ph 4-60.333333
quercus0.333333
auburn0.333333
LOWER IN depth (soil) 25-50cm0.333333
mollisol0.333333
sandy loam0.333333
sandy loam soil0.333333
bulk soil0.285714
peat soil0.250000
urban biome0.250000
LOWER IN root structure0.250000
ph<50.250000
LOWER IN ph&gt;50.250000
root endosphere0.250000
depth (soil) 15cm0.250000
depth (soil) 0-30 cm0.250000
ph 4-4.50.250000
plant disease0.250000
maize field0.250000
depth (soil) 0-10cm0.230769
ph 4-50.230769
depth 5cm0.200000
london0.200000
ph 50.200000
peatland0.166667
silt loam0.166667
wetland area0.142857
new york city0.142857
LOWER IN glycine max0.142857
glycine max0.142857
solanum lycopersicum0.142857
ecuador0.142857
Fraction of annotations for the query sequences containing the term
TermScore
soil0.785714
united states of america0.238095
rhizosphere0.214286
china0.190476
state of michigan0.190476
kellogg biological station0.190476
mesic type hapludalf0.190476
kalamazoo loam0.190476
ph 4-50.166667
depth (soil) 0-20cm0.142857
depth (soil) 0-10cm0.142857
mature barley plants0.119048
days 1800.119048
hordeum vulgare0.119048
depth (soil) 15cm0.119048
quzhou county0.119048
zhejiang province0.119048
depth (soil) 25-50cm0.119048
park0.095238
canada0.095238
bulk soil0.095238
panicum virgatum0.095238
topsoil0.071429
woodland area0.071429
forest ecosystem0.071429
minas gerais state0.071429
campos rupestres0.071429
brazil0.071429
corn0.071429
depth 50-100m0.071429
restored prairie0.071429
depth (soil) 0-30 cm0.071429
united kingdom0.071429
oak0.071429
quercus0.071429
auburn0.071429
alabama0.071429
upland soil0.071429
agricultural field0.071429
ultisol0.071429
depth (soil) 10-25cm0.071429
bon portage island0.047619
burrow0.047619
province of quebec0.047619
barbacenia macrantha0.047619
biochar0.047619
continuous corn0.047619
miscanthus0.047619
mountain0.047619
switzerland0.047619
elevation 2000-3000m0.047619
siliceous parent material0.047619
ph 4-4.50.047619
london0.047619
ph 50.047619
lower saxony0.047619
sandy soil0.047619
germany0.047619
maize field0.047619
dekalb county0.047619
illinois0.047619
state of illinois0.047619
peatland0.023810
peat soil0.023810
sphagnum bog0.023810
temperate grassland biome0.023810
depth 5cm0.023810
wetland area0.023810
urban biome0.023810
new york city0.023810
central park0.023810
ph0.023810
ph<5.50.023810
LOWER IN ph&gt;5.50.023810
bird0.023810
oceanodroma leucorhoa0.023810
seabird0.023810
LOWER IN bird0.023810
LOWER IN seabird0.023810
LOWER IN oceanodroma leucorhoa0.023810
LOWER IN soilwater0.023810
LOWER IN water0.023810
LOWER IN rhizosphere0.023810
LOWER IN glycine max0.023810
LOWER IN soybean0.023810
LOWER IN root structure0.023810
glycine max0.023810
soybean0.023810
LOWER IN root0.023810
temperate woodland biome0.023810
temperate deciduos forest0.023810
ph<50.023810
LOWER IN ph&gt;50.023810
subpolar coniferous forest biome0.023810
boreal forest0.023810
southern temperate forest0.023810
temperate broadleaf and mixed forest biome0.023810
rock0.023810
root endosphere0.023810
root0.023810
Exp. ID User ID Description Date Region Flag Sequences
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 17
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 327
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org