Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCAGATTTACTGGGCGTAAAGCGCGTGTAGGCGGCTGGTTAGGTGTGATGTGAAATCTTCCGGCTCAACCGGAAAACTGCATTGCAAACCGGCCTGGCTAGAGTGCAGGAGAGGGAAGCGGAATTCCAG
common ontology terms
term enrichment score
TermScore
kalamazoo loam0.411765
mesic type hapludalf0.411765
kellogg biological station0.411765
soil0.362999
restored prairie0.230769
panicum virgatum0.215686
depth 25-50cm0.194690
miscanthus0.183673
state of michigan0.168675
corn0.168224
depth 50-100m0.168224
ph 60.154696
reforestation0.148936
shaanxi province0.148936
robinia pseudoacacia0.148936
cultivated environment0.141892
loess plateau0.138614
depth 0-10cm0.136253
continuous corn0.130435
20 years0.130435
glycine max0.127660
silt loam0.114754
paddy field soil0.114286
state of new york0.109091
depth 10-25cm0.105263
zea mays0.100000
rhizosphere0.098870
state of tennessee0.095238
silt clay loam0.090909
united states0.090909
des moines0.090909
nicollet soil series0.090909
province of quebec0.086957
iowa0.086957
china0.075482
canada0.075472
zhejiang province0.074074
agricultural field0.074074
depth 30-75cm0.069767
coarse-loamy soil0.069767
kelley0.069767
subsurface drainage0.069767
merlot0.069767
grapevine0.069767
state of idaho0.067416
vitis vinifera0.067416
LOWER IN root0.065934
depth 0-5cm0.063158
united states of america0.055080
depth 0-20cm0.051724
ph<60.048193
LOWER IN ph&gt;60.048193
boreal wetland0.047619
seasonal frozen marsh0.047619
copper0.047619
svalbard archipelago0.047619
depth 100-150cm0.047619
populus0.047619
ph 5.50.047619
tomato0.047619
mesocosm0.047619
day 820.047619
LOWER IN 30 years0.047619
northeast china0.046512
wetland area0.046512
depth 0-15cm0.046512
peat soil0.045455
permafrost0.045455
topsoil0.044944
forest ecosystem0.044944
tree0.044444
solanum lycopersicum0.042553
state of georgia0.042553
kingdom of norway0.041667
LOWER IN rhizosphere0.041237
depth 150-200cm0.024390
LOWER IN depth (soil) 20-30cm0.024390
subpolar coniferous forest biome0.024390
boreal forest0.024390
depth 30-75cm0.024390
LOWER IN silt loam0.024390
reunion island0.024390
day 10.024390
LOWER IN day 120.024390
stover ammendment soil0.024390
ph 5.40.024390
ames0.024390
ph 7.40.024390
soilwater0.024390
LOWER IN depth 60-90cm0.024390
slit loam0.024390
slit loam soil0.024390
ph 6.20.024390
depth 40-100cm0.024390
depth 100-300cm0.024390
depth 0-40cm0.024390
stover ammendment 0.024390
LOWER IN cherokia georgiana georgiana0.024390
LOWER IN millipede0.024390
hubei province0.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
paddy field soil0.666667
ph 60.666667
ph<60.666667
LOWER IN ph&gt;60.666667
continuous corn0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
silt clay loam0.500000
depth 30-75cm0.500000
boreal wetland0.500000
seasonal frozen marsh0.500000
copper0.500000
svalbard archipelago0.500000
depth 100-150cm0.500000
depth 150-200cm0.500000
LOWER IN depth (soil) 20-30cm0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
depth 30-75cm0.500000
LOWER IN silt loam0.500000
reunion island0.500000
day 10.500000
LOWER IN day 120.500000
coarse-loamy soil0.500000
stover ammendment soil0.500000
ph 5.40.500000
united states0.500000
ames0.500000
des moines0.500000
nicollet soil series0.500000
ph 7.40.500000
soilwater0.500000
kelley0.500000
subsurface drainage0.500000
populus0.500000
ph 5.50.500000
LOWER IN depth 60-90cm0.500000
tomato0.500000
slit loam0.500000
slit loam soil0.500000
ph 6.20.500000
mesocosm0.500000
reforestation0.500000
shaanxi province0.500000
robinia pseudoacacia0.500000
depth 40-100cm0.500000
20 years0.500000
merlot0.500000
grapevine0.500000
depth 100-300cm0.500000
depth 0-40cm0.500000
day 820.500000
stover ammendment 0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
hubei province0.500000
field soil0.500000
contaminated sediment0.500000
quesnel lake0.500000
LOWER IN soilwater0.500000
10 years0.500000
LOWER IN 30 years0.500000
LOWER IN glycine max0.500000
LOWER IN soybean0.500000
LOWER IN 10 years0.500000
LOWER IN triticum aestivum0.500000
LOWER IN agricultural field0.500000
central park0.500000
LOWER IN root structure0.500000
glycine max0.428571
cultivated environment0.375000
province of quebec0.333333
corn0.333333
depth 25-50cm0.333333
depth 50-100m0.333333
northeast china0.333333
wetland area0.333333
LOWER IN depth 25-50cm0.333333
LOWER IN depth 0-30cm0.333333
orchard0.333333
citrus0.333333
LOWER IN depth 10-25cm0.333333
hokkaido0.333333
iowa0.333333
depth (soil) 30-60cm0.333333
depth 15-30cm0.333333
depth 10-25cm0.333333
heilongjiang province0.333333
black soil0.333333
mollisol0.333333
state of idaho0.333333
depth 0-15cm0.333333
LOWER IN plant litter0.333333
loess plateau0.333333
vitis vinifera0.333333
ph 5.90.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.925000
united states of america0.575000
state of michigan0.350000
kalamazoo loam0.350000
mesic type hapludalf0.350000
kellogg biological station0.350000
china0.237500
restored prairie0.150000
depth 25-50cm0.137500
panicum virgatum0.137500
corn0.112500
miscanthus0.112500
depth 50-100m0.112500
cultivated environment0.087500
depth 0-10cm0.087500
rhizosphere0.087500
ph 60.087500
silt loam0.087500
reforestation0.087500
shaanxi province0.087500
loess plateau0.087500
robinia pseudoacacia0.087500
continuous corn0.075000
state of new york0.075000
glycine max0.075000
20 years0.075000
canada0.062500
state of tennessee0.062500
paddy field soil0.062500
zea mays0.062500
depth 10-25cm0.062500
province of quebec0.050000
silt clay loam0.050000
zhejiang province0.050000
iowa0.050000
agricultural field0.050000
united states0.050000
des moines0.050000
nicollet soil series0.050000
depth 30-75cm0.037500
research facility0.037500
depth 0-5cm0.037500
coarse-loamy soil0.037500
kelley0.037500
subsurface drainage0.037500
state of idaho0.037500
LOWER IN root0.037500
vitis vinifera0.037500
merlot0.037500
grapevine0.037500
depth 0-20cm0.037500
peat soil0.025000
northeast china0.025000
boreal wetland0.025000
seasonal frozen marsh0.025000
wetland area0.025000
copper0.025000
LOWER IN control0.025000
permafrost0.025000
kingdom of norway0.025000
svalbard archipelago0.025000
depth 100-150cm0.025000
topsoil0.025000
forest ecosystem0.025000
populus0.025000
tree0.025000
ph<60.025000
LOWER IN ph&gt;60.025000
ph 5.50.025000
depth 0-15cm0.025000
LOWER IN rhizosphere0.025000
solanum lycopersicum0.025000
tomato0.025000
state of georgia0.025000
mesocosm0.025000
day 820.025000
LOWER IN 30 years0.025000
depth 150-200cm0.012500
LOWER IN depth (soil) 20-30cm0.012500
subpolar coniferous forest biome0.012500
boreal forest0.012500
woodland area0.012500
LOWER IN depth 25-50cm0.012500
depth 30-75cm0.012500
LOWER IN depth 0-30cm0.012500
LOWER IN silt loam0.012500
orchard0.012500
reunion island0.012500
citrus0.012500
day 10.012500
LOWER IN day 120.012500
stover ammendment soil0.012500
LOWER IN depth 10-25cm0.012500
hokkaido0.012500
ph 5.40.012500
japan0.012500
ames0.012500
depth (soil) 30-60cm0.012500
ph 7.40.012500
water0.012500
Exp. ID User ID Description Date Region Flag Sequences
265amnondominant soil, canada, province of quebec2017-12-11v4No1 / 3
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of restored prairie at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 4
821sheryoDominant in soil of miscanthus field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-02v4No1 / 4
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 6
821sheryoDominant in soil of switchgrass field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 6
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 7
462amnondominant united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 8
821sheryoDominant in soil of miscanthus field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 8
821sheryoDominant in soil of restored prairie at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 9
506amnondominant soil, peat soil, northeast china, depth 0-10cm, boreal wetland, seasonal frozen marsh, wetland area, china2019-03-16v4No1 / 14
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 141
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 173
347amnon high in depth 100-150cm depth 150-200cm compared to depth (soil) 20-30cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 221
357amnoncommon soil, subpolar coniferous forest biome, topsoil, depth 0-10cm, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 543
462amnon high in depth 30-75cm silt clay loam compared to depth 0-30cm silt loam in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 665
506amnoncommon soil, peat soil, northeast china, depth 0-10cm, boreal wetland, seasonal frozen marsh, wetland area, china2019-03-16v4No1 / 690
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 728
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 747
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth 25-50cm compared to depth 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 812
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, topsoil, hokkaido, depth 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 834
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, depth (soil) 30-60cm, nicollet soil series, ph 7.4)2021-06-15v4No1 / 839
265amnoncommon water, canada, province of quebec, soilwater2017-12-11v4No1 / 841
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment2019-01-13v4No1 / 908
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth 10-25cm compared to depth 0-10cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 930
414amnon high in ph<6 npk fertilizer compared to ph>6 in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 963
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
266amnoncommon in soil from PAR garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth 0-15cm compared to depth 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
265amnoncommon soil, canada, province of quebec2017-12-11v4No1 / 1090
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 1135
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
788amnon high in soil compared to plant litter in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1280
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
266amnonCommon in soil from MAH garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1299
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
837sheryoבCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82, stover ammendment )2020-03-27v4No1 / 1327
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, depth 0-5cm, ph 6, coarse-loamy soil, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to feces cherokia georgiana georgiana millipede in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
265amnon high in soil compared to water soilwater in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3368
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in park soil urban biome new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org