Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGCCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
urban slum0.285714
dhaka0.285714
bangladesh0.250000
LOWER IN irritable bowel syndrome0.222222
13-year-old human stage0.222222
LOWER IN 1-month-old human stage0.181818
1-year-old human stage0.173913
juvenile organism0.166667
LOWER IN finland0.166667
belgium0.153846
india0.153846
kingdom of denmark0.142857
obsolete_juvenile stage0.133333
infant0.114286
crohn's disease0.105263
kingdom of spain0.076923
LOWER IN under-1-year-old human stage0.076923
age0.076923
infant stage0.066667
homo sapiens0.034014
feces0.028571
adult0.010471
LOWER IN control0.010256
control0.010256
Fraction of dbbact annotations with this term covered by the query
TermScore
urban slum0.500000
dhaka0.500000
bangladesh0.333333
LOWER IN irritable bowel syndrome0.250000
13-year-old human stage0.250000
LOWER IN 1-month-old human stage0.166667
juvenile organism0.142857
LOWER IN finland0.142857
belgium0.125000
india0.125000
1-year-old human stage0.111111
kingdom of denmark0.111111
obsolete_juvenile stage0.100000
crohn's disease0.071429
infant0.066667
kingdom of spain0.047619
LOWER IN under-1-year-old human stage0.047619
age0.047619
infant stage0.040000
homo sapiens0.017301
feces0.014493
adult0.005376
LOWER IN control0.005263
control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces1.000000
1-year-old human stage0.400000
infant0.400000
belgium0.200000
LOWER IN control0.200000
crohn's disease0.200000
adult0.200000
kingdom of spain0.200000
control0.200000
LOWER IN irritable bowel syndrome0.200000
13-year-old human stage0.200000
obsolete_juvenile stage0.200000
juvenile organism0.200000
LOWER IN finland0.200000
india0.200000
LOWER IN under-1-year-old human stage0.200000
urban slum0.200000
infant stage0.200000
dhaka0.200000
bangladesh0.200000
LOWER IN 1-month-old human stage0.200000
kingdom of denmark0.200000
age0.200000

Problems / suggestions? Please email info AT dbbact DOT org