Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGCCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
LOWER IN irritable bowel syndrome0.400000
13-year-old human stage0.250000
juvenile organism0.200000
LOWER IN 1-month-old human stage0.200000
india0.181818
LOWER IN finland0.181818
belgium0.166667
kingdom of denmark0.166667
obsolete_juvenile stage0.142857
crohn's disease0.125000
1-year-old human stage0.105263
kingdom of spain0.080000
age0.080000
infant0.066667
homo sapiens0.029091
feces0.025157
adult0.011299
LOWER IN control0.010582
control0.010582
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN irritable bowel syndrome1.000000
13-year-old human stage0.250000
juvenile organism0.166667
LOWER IN 1-month-old human stage0.166667
india0.142857
LOWER IN finland0.142857
belgium0.125000
kingdom of denmark0.125000
obsolete_juvenile stage0.100000
crohn's disease0.083333
1-year-old human stage0.066667
kingdom of spain0.047619
age0.047619
infant0.038462
homo sapiens0.014760
feces0.012739
adult0.005780
LOWER IN control0.005405
control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
crohn's disease0.250000
LOWER IN control0.250000
belgium0.250000
control0.250000
LOWER IN irritable bowel syndrome0.250000
adult0.250000
kingdom of spain0.250000
india0.250000
LOWER IN finland0.250000
juvenile organism0.250000
obsolete_juvenile stage0.250000
13-year-old human stage0.250000
age0.250000
1-year-old human stage0.250000
LOWER IN 1-month-old human stage0.250000
infant0.250000
kingdom of denmark0.250000

Problems / suggestions? Please email info AT dbbact DOT org