Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.591398
feces0.496313
adult0.384327
united states of america0.245518
child0.194963
obsolete_juvenile stage0.169014
city0.153846
infant0.149915
china0.108571
control0.108333
jiangsu province0.082192
india0.077220
state of colorado0.071685
age0.070922
female0.070588
heterosexual0.062500
msw0.062500
rural community0.060914
rectum0.059701
finland0.058824
state of california0.050000
LOWER IN age < 1 year0.047619
state of oklahoma0.047431
LOWER IN rural community0.047244
age 3-60.046875
obesity0.046875
age 60-790.046875
age 30-500.046875
age 130.046875
ulcerative colitis0.046512
biopsy0.046332
kingdom of denmark0.045802
duodenum0.044776
juvenile organism0.044776
LOWER IN crohn's disease0.044280
italy0.044280
colon0.040268
caecum0.039088
diabetes mellitus0.032000
age < 3 years0.032000
age > 1 year0.032000
LOWER IN gay0.032000
LOWER IN msm0.032000
LOWER IN homosexual0.032000
jordan0.031746
age one year0.031746
bangladesh0.031746
denver0.031746
age 30 days0.031746
dairy0.031746
thailand0.031746
hmong0.031746
age 8-120.031746
lima0.031746
shantytown0.031746
new delhi0.031746
age >940.031746
small village0.031746
LOWER IN small village0.031746
age 50-60 years0.031746
nanning city prefecture0.031746
wastewater treatment plant0.031746
LOWER IN mouth mucosa0.031746
chuquisaca department0.031746
age 5-13 years0.031746
state of michigan0.031008
biopsy site0.030769
small intestine0.030769
bolivia0.030769
united kingdom0.030534
ovis aries0.029851
canada0.029412
LOWER IN mouth0.029412
mus musculus0.029126
LOWER IN adult0.028777
kingdom of spain0.028169
dog0.028169
skin0.027397
canis lupus familiaris0.026667
LOWER IN control0.025105
research facility0.022430
mouse0.018182
type i diabetes mellitus0.016129
anorexia nervosa0.016129
LOWER IN milk0.016129
LOWER IN age 2 months0.016129
plant diet0.016129
daycare0.016129
age 1-5 years0.016129
schizophrenia0.016129
native american0.016129
arapaho0.016129
cheyenne0.016129
commonwealth of pennsylvania0.016129
LOWER IN age 8-120.016129
LOWER IN age 13-140.016129
age 17-290.016129
age 200.016129
azerbaijan0.016129
mild0.016129
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN age < 1 year0.750000
diabetes mellitus0.666667
age < 3 years0.666667
age > 1 year0.666667
state of oklahoma0.666667
heterosexual0.666667
msw0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
india0.666667
obsolete_juvenile stage0.600000
LOWER IN rural community0.600000
jordan0.500000
type i diabetes mellitus0.500000
anorexia nervosa0.500000
LOWER IN milk0.500000
LOWER IN age 2 months0.500000
plant diet0.500000
age one year0.500000
daycare0.500000
age 1-5 years0.500000
bangladesh0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
commonwealth of pennsylvania0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 17-290.500000
denver0.500000
obesity0.500000
age 200.500000
age 30 days0.500000
dairy0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 8-120.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
LOWER IN exocrine pancreatic insufficiency0.500000
cron diet0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
obese body mass index status0.500000
db/db mouse0.500000
toronto0.500000
LOWER IN india0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 1-3 years0.500000
spondylitis0.500000
spondyloarthritis0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN thailand0.500000
algonquin provincial park0.500000
province of ontario0.500000
age 3-5 weeks0.500000
deer mice0.500000
peromyscus maniculatus0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio anubis0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.901639
feces0.893443
united states of america0.401639
adult0.377049
china0.155738
child0.122951
control0.106557
obsolete_juvenile stage0.098361
city0.098361
infant0.090164
female0.049180
jiangsu province0.049180
age0.040984
state of colorado0.040984
india0.040984
state of california0.032787
finland0.032787
heterosexual0.032787
msw0.032787
rectum0.032787
rural community0.032787
LOWER IN control0.024590
LOWER IN age < 1 year0.024590
kingdom of denmark0.024590
ulcerative colitis0.024590
LOWER IN crohn's disease0.024590
state of oklahoma0.024590
age 3-60.024590
italy0.024590
obesity0.024590
caecum0.024590
colon0.024590
biopsy0.024590
age 60-790.024590
age 30-500.024590
mus musculus0.024590
research facility0.024590
duodenum0.024590
age 130.024590
juvenile organism0.024590
LOWER IN rural community0.024590
jordan0.016393
diabetes mellitus0.016393
LOWER IN adult0.016393
age < 3 years0.016393
age > 1 year0.016393
age one year0.016393
bangladesh0.016393
state of michigan0.016393
denver0.016393
ovis aries0.016393
age 30 days0.016393
dairy0.016393
thailand0.016393
hmong0.016393
biopsy site0.016393
LOWER IN gay0.016393
LOWER IN msm0.016393
LOWER IN homosexual0.016393
age 8-120.016393
lima0.016393
shantytown0.016393
mouse0.016393
kingdom of spain0.016393
new delhi0.016393
small intestine0.016393
age >940.016393
canis lupus familiaris0.016393
dog0.016393
small village0.016393
united kingdom0.016393
LOWER IN small village0.016393
canada0.016393
age 50-60 years0.016393
nanning city prefecture0.016393
wastewater treatment plant0.016393
LOWER IN mouth mucosa0.016393
LOWER IN mouth0.016393
chuquisaca department0.016393
bolivia0.016393
age 5-13 years0.016393
skin0.016393
type i diabetes mellitus0.008197
venezuela0.008197
hunter gatherer0.008197
amerindian0.008197
anorexia nervosa0.008197
breast milk0.008197
LOWER IN milk0.008197
age 1 year0.008197
LOWER IN age 2 months0.008197
diet0.008197
plant diet0.008197
LOWER IN animal product diet0.008197
russia0.008197
colombia0.008197
medellin metropolitan area0.008197
daycare0.008197
age 1-5 years0.008197
commonwealth of virginia0.008197
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in diabetes mellitus type i diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
24amnondisappears on transition to cow milk ( high in breast milk compared to milk in homo sapiens feces infant )2016-12-01v4No1 / 35
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obesity, obese body mass index status, db/db mouse2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in algonquin provincial park province of ontario age 3-5 weeks deer mice peromyscus maniculatus canada feces )2019-07-28v3No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org