Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.582085
feces0.502936
adult0.371884
united states of america0.236822
child0.218182
obsolete_juvenile stage0.161074
city0.147239
infant0.143089
china0.128780
control0.114566
jiangsu province0.078431
india0.073260
italy0.068650
state of colorado0.068259
age0.067568
female0.067227
heterosexual0.059259
msw0.059259
rural community0.057831
rectum0.056738
finland0.055944
state of california0.047904
LOWER IN age < 1 year0.045113
state of oklahoma0.044944
age 5-13 years0.044944
LOWER IN rural community0.044776
age 3-60.044444
obesity0.044444
age 60-790.044444
age 30-500.044444
age 130.044444
ulcerative colitis0.044118
biopsy0.043956
kingdom of denmark0.043478
juvenile organism0.042553
LOWER IN crohn's disease0.042105
duodenum0.042105
colon0.038095
caecum0.037037
canada0.030534
diabetes mellitus0.030303
age < 3 years0.030303
age > 1 year0.030303
LOWER IN gay0.030303
LOWER IN msm0.030303
LOWER IN homosexual0.030303
jordan0.030075
age 2-4 years0.030075
age one year0.030075
bangladesh0.030075
denver0.030075
age 30 days0.030075
dairy0.030075
thailand0.030075
hmong0.030075
age 8-120.030075
lima0.030075
shantytown0.030075
new delhi0.030075
age >940.030075
small village0.030075
LOWER IN small village0.030075
age 50-60 years0.030075
nanning city prefecture0.030075
ruminal fluid0.030075
alpine meadow0.030075
wastewater treatment plant0.030075
chuquisaca department0.030075
LOWER IN mouth mucosa0.030075
yak0.029630
state of michigan0.029412
biopsy site0.029197
small intestine0.029197
bos grunniens0.029197
bolivia0.029197
united kingdom0.028986
ovis aries0.028369
tibetan plateau0.028369
mus musculus0.028169
LOWER IN mouth0.027972
LOWER IN adult0.027397
kingdom of spain0.026846
dog0.026490
rumen0.026144
skin0.025974
canis lupus familiaris0.025157
LOWER IN control0.023810
research facility0.021858
mouse0.017621
type i diabetes mellitus0.015267
anorexia nervosa0.015267
LOWER IN mammalian milk beverage0.015267
LOWER IN age 2 months0.015267
plant diet0.015267
daycare0.015267
age 1-5 years0.015267
schizophrenia0.015267
native american0.015267
arapaho0.015267
cheyenne0.015267
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
LOWER IN age < 1 year0.750000
diabetes mellitus0.666667
age < 3 years0.666667
age > 1 year0.666667
state of oklahoma0.666667
age 5-13 years0.666667
heterosexual0.666667
msw0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
india0.666667
obsolete_juvenile stage0.600000
LOWER IN rural community0.600000
jordan0.500000
child0.500000
type i diabetes mellitus0.500000
age 2-4 years0.500000
anorexia nervosa0.500000
LOWER IN mammalian milk beverage0.500000
LOWER IN age 2 months0.500000
plant diet0.500000
age one year0.500000
daycare0.500000
age 1-5 years0.500000
bangladesh0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
commonwealth of pennsylvania0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 17-290.500000
quito0.500000
denver0.500000
obesity0.500000
age 200.500000
age 30 days0.500000
dairy0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 8-120.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
LOWER IN exocrine pancreatic insufficiency0.500000
cron diet0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
obese body mass index status0.500000
db/db mouse0.500000
toronto0.500000
LOWER IN india0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 1-3 years0.500000
spondyloarthritis0.500000
spondylitis0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN thailand0.500000
peromyscus maniculatus0.500000
deer mice0.500000
age 3-5 weeks0.500000
province of ontario0.500000
algonquin provincial park0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.883721
feces0.883721
united states of america0.379845
adult0.364341
china0.170543
child0.139535
control0.116279
obsolete_juvenile stage0.093023
city0.093023
infant0.085271
female0.046512
jiangsu province0.046512
italy0.038760
age0.038760
state of colorado0.038760
india0.038760
state of california0.031008
finland0.031008
heterosexual0.031008
msw0.031008
rectum0.031008
rural community0.031008
LOWER IN control0.023256
LOWER IN age < 1 year0.023256
kingdom of denmark0.023256
LOWER IN crohn's disease0.023256
ulcerative colitis0.023256
state of oklahoma0.023256
age 3-60.023256
age 5-13 years0.023256
obesity0.023256
caecum0.023256
colon0.023256
biopsy0.023256
age 60-790.023256
age 30-500.023256
mus musculus0.023256
research facility0.023256
duodenum0.023256
age 130.023256
juvenile organism0.023256
LOWER IN rural community0.023256
jordan0.015504
diabetes mellitus0.015504
age 2-4 years0.015504
LOWER IN adult0.015504
age < 3 years0.015504
age > 1 year0.015504
age one year0.015504
bangladesh0.015504
state of michigan0.015504
denver0.015504
ovis aries0.015504
age 30 days0.015504
dairy0.015504
thailand0.015504
hmong0.015504
biopsy site0.015504
LOWER IN gay0.015504
LOWER IN msm0.015504
LOWER IN homosexual0.015504
age 8-120.015504
lima0.015504
shantytown0.015504
mouse0.015504
kingdom of spain0.015504
new delhi0.015504
small intestine0.015504
age >940.015504
canis lupus familiaris0.015504
dog0.015504
small village0.015504
united kingdom0.015504
LOWER IN small village0.015504
canada0.015504
age 50-60 years0.015504
nanning city prefecture0.015504
ruminal fluid0.015504
rumen0.015504
alpine meadow0.015504
tibetan plateau0.015504
yak0.015504
bos grunniens0.015504
wastewater treatment plant0.015504
bolivia0.015504
chuquisaca department0.015504
LOWER IN mouth mucosa0.015504
LOWER IN mouth0.015504
skin0.015504
type i diabetes mellitus0.007752
LOWER IN autistic disorder0.007752
venezuela0.007752
hunter gatherer0.007752
amerindian0.007752
anorexia nervosa0.007752
breast milk0.007752
LOWER IN mammalian milk beverage0.007752
age 1 year0.007752
LOWER IN age 2 months0.007752
diet0.007752
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
564amnon high in control compared to autistic disorder in feces italy age 2-4 years child homo sapiens 2019-11-18v3No1 / 14
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v4No1 / 35
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
561amnon high in spring green stage diet compared to grass growth diet summer in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 397
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
561amnoncommon ruminal fluid, rumen, alpine meadow, tibetan plateau, china, yak, bos grunniens2019-11-05v3No1 / 670
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org