Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTACCTAAGCAGAGGGTGAAAGGCACTGGCTTAACCAATGTCAGCCCCCTGAACTGGGTACCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
rural community0.315789
small village0.206897
LOWER IN united states of america0.181818
chuquisaca department0.148148
age 5-13 years0.137931
LOWER IN city0.133333
bolivia0.129032
homo sapiens0.121963
child0.112676
feces0.112150
adult0.109190
state of new york0.093023
LOWER IN usa born0.080000
non usa born0.080000
himalayas0.080000
low income0.080000
LOWER IN sewer0.080000
LOWER IN pancreatitis0.080000
LOWER IN acute pancreatitis0.080000
el salvador0.080000
LOWER IN lima0.080000
LOWER IN shantytown0.080000
cron diet0.080000
age >940.080000
LOWER IN age 30-500.080000
LOWER IN age 60-790.080000
age 60-790.080000
LOWER IN age 3-60.080000
LOWER IN age 8-120.080000
LOWER IN arm0.080000
LOWER IN forearm0.080000
rhesus macaque0.080000
hispanic or latin american0.076923
nepal0.076923
south america0.076923
LOWER IN wastewater treatment plant0.076923
nanchang city prefecture0.076923
LOWER IN neomycin0.076923
LOWER IN european0.076923
asian0.076923
LOWER IN american diet0.076923
amerindian0.076923
venezuela0.076923
age 30-500.076923
LOWER IN age 1 month0.076923
amsterdam0.074074
LOWER IN vancomycin0.074074
LOWER IN caucasian0.074074
africa0.074074
hunter gatherer0.074074
LOWER IN body mass index0.071429
guangzhou city prefecture0.071429
LOWER IN msw0.071429
LOWER IN heterosexual0.071429
caloric restriction diet0.071429
msm0.068966
homosexual0.068966
kingdom of the netherlands0.068966
thailand0.068966
egypt0.068966
macaca mulatta0.068966
LOWER IN mouth mucosa0.068966
LOWER IN metronidazole0.066667
age 3 months0.066667
LOWER IN mouth0.066667
city0.065574
male0.063492
low bmi0.062500
LOWER IN skin0.062500
LOWER IN high bmi0.060606
LOWER IN duodenum0.060606
obsolete_juvenile stage0.060606
monkey0.060606
LOWER IN crohn's disease0.058824
LOWER IN child0.057143
LOWER IN antibiotic0.055556
captive0.050000
china0.046967
united states of america0.046027
LOWER IN female0.043478
state of california0.042553
diet0.042553
control0.030769
research facility0.012048
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.500000
LOWER IN usa born0.500000
non usa born0.500000
himalayas0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
cron diet0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
rhesus macaque0.500000
rural community0.400000
hispanic or latin american0.333333
nepal0.333333
south america0.333333
LOWER IN wastewater treatment plant0.333333
nanchang city prefecture0.333333
LOWER IN neomycin0.333333
LOWER IN european0.333333
asian0.333333
LOWER IN american diet0.333333
amerindian0.333333
venezuela0.333333
age 30-500.333333
age 5-13 years0.333333
LOWER IN age 1 month0.333333
LOWER IN united states of america0.300000
LOWER IN city0.285714
amsterdam0.250000
LOWER IN vancomycin0.250000
LOWER IN caucasian0.250000
africa0.250000
hunter gatherer0.250000
bolivia0.250000
LOWER IN body mass index0.200000
guangzhou city prefecture0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
caloric restriction diet0.200000
msm0.166667
homosexual0.166667
kingdom of the netherlands0.166667
thailand0.166667
egypt0.166667
macaca mulatta0.166667
LOWER IN mouth mucosa0.166667
LOWER IN metronidazole0.142857
age 3 months0.142857
LOWER IN mouth0.142857
low bmi0.111111
LOWER IN skin0.111111
LOWER IN high bmi0.100000
state of new york0.100000
LOWER IN duodenum0.100000
obsolete_juvenile stage0.100000
monkey0.100000
LOWER IN crohn's disease0.090909
child0.083333
LOWER IN child0.083333
LOWER IN antibiotic0.076923
homo sapiens0.065134
adult0.060976
feces0.059406
captive0.058824
city0.052632
male0.050000
LOWER IN female0.043478
state of california0.041667
diet0.041667
china0.025806
united states of america0.024896
control0.017442
research facility0.006993
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.956522
adult0.521739
united states of america0.304348
rural community0.260870
china0.260870
child0.173913
small village0.130435
LOWER IN united states of america0.130435
control0.130435
LOWER IN city0.086957
state of new york0.086957
male0.086957
city0.086957
age 5-13 years0.086957
bolivia0.086957
chuquisaca department0.086957
LOWER IN body mass index0.043478
LOWER IN high bmi0.043478
low bmi0.043478
LOWER IN usa born0.043478
non usa born0.043478
hispanic or latin american0.043478
nepal0.043478
himalayas0.043478
LOWER IN crohn's disease0.043478
guangzhou city prefecture0.043478
LOWER IN msw0.043478
LOWER IN heterosexual0.043478
msm0.043478
homosexual0.043478
amsterdam0.043478
kingdom of the netherlands0.043478
south america0.043478
low income0.043478
LOWER IN sewer0.043478
LOWER IN wastewater treatment plant0.043478
LOWER IN female0.043478
nanchang city prefecture0.043478
LOWER IN pancreatitis0.043478
LOWER IN acute pancreatitis0.043478
el salvador0.043478
LOWER IN lima0.043478
LOWER IN shantytown0.043478
LOWER IN metronidazole0.043478
LOWER IN neomycin0.043478
LOWER IN vancomycin0.043478
LOWER IN antibiotic0.043478
state of california0.043478
LOWER IN caucasian0.043478
LOWER IN european0.043478
asian0.043478
thailand0.043478
cron diet0.043478
caloric restriction diet0.043478
LOWER IN american diet0.043478
diet0.043478
africa0.043478
LOWER IN duodenum0.043478
obsolete_juvenile stage0.043478
egypt0.043478
hunter gatherer0.043478
amerindian0.043478
venezuela0.043478
age >940.043478
LOWER IN age 30-500.043478
LOWER IN age 60-790.043478
age 30-500.043478
age 60-790.043478
LOWER IN age 3-60.043478
LOWER IN age 8-120.043478
LOWER IN child0.043478
LOWER IN skin0.043478
LOWER IN arm0.043478
LOWER IN forearm0.043478
LOWER IN age 1 month0.043478
age 3 months0.043478
monkey0.043478
rhesus macaque0.043478
macaca mulatta0.043478
research facility0.043478
captive0.043478
LOWER IN mouth mucosa0.043478
LOWER IN mouth0.043478
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 75
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org