Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTTTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.426082
canis lupus familiaris0.344686
dog0.315789
homo sapiens0.283009
china0.260019
adult0.232670
united states of america0.203018
research facility0.151493
italy0.137705
chicken0.111810
gallus gallus0.110574
child0.101695
male0.099071
city of melbourne0.091476
australia0.083939
mus musculus0.077066
control0.075190
caecum0.073090
foxhound0.071146
zoological garden0.066977
LOWER IN control0.066895
captive0.065336
mouse0.064801
infant0.063875
rectum0.062257
colon0.057851
cat0.056623
cobb broiler chicken0.056225
formula fed0.056225
felis catus0.055833
age 35 days0.054688
sweden0.051852
acinonyx jubatus0.049383
kingdom of spain0.049296
obsolete_juvenile stage0.047059
2-5 year-old child stage0.046693
israel0.046065
female0.045381
french republic0.043796
wild0.042403
wolf0.041379
heterosexual0.041096
msw0.041096
seattle0.040816
colonized germ free0.040816
obesity0.040541
fourth decade human stage0.040541
state of north carolina0.040000
zhejiang province0.039735
broiler chicken0.039604
rattus norvegicus0.039604
rat0.038835
rectal swab0.038462
state of new york0.037736
canis lupus0.035928
skin0.034483
farm0.033898
cheetah0.033195
age 30 days0.033195
hydrolized diet0.032922
ulcerative colitis0.032564
crohn's disease0.032389
state of colorado0.032389
germany0.031963
adult organism0.031873
cloaca0.031621
russia0.031373
antibiotic0.031209
ovis aries0.030888
high bmi0.030651
female organism0.030651
city0.030573
canada0.028070
namibia0.025210
panthera leo0.025052
lion0.025052
dairy0.024896
age 2-7 years0.024896
cftr s489x0.024896
sigmoid colon brushing0.024896
indonesia0.024896
municipality of yogyakarta0.024896
lake hulun0.024896
new zealand0.024896
LOWER IN breast fed0.024896
hispanic or latin american0.024896
fifth decade human stage0.024896
jinzhou city prefecture0.024896
commonwealth of pennsylvania0.024590
estonia0.024590
cystic fibrosis0.024590
colonic mucosa0.024590
milan0.024590
republic of china0.024590
LOWER IN duodenum0.024390
sigmoid colon0.024291
south korea0.024291
taiwan0.024291
mongolia0.024000
high fiber0.023715
Fraction of dbbact annotations with this term covered by the query
TermScore
china9.000000
city of melbourne2.000000
colon1.000000
namibia1.000000
los angeles district1.000000
acute pancreatitis1.000000
pancreatitis1.000000
bile1.000000
glasgow1.000000
lima1.000000
acinonyx jubatus0.750000
wolf0.750000
canis lupus familiaris0.730769
dog0.695652
cheetah0.666667
age 30 days0.666667
panthera leo0.666667
lion0.666667
heterosexual0.600000
msw0.600000
cat0.571429
LOWER IN primary progressive multiple sclerosis0.500000
panthera tigris0.500000
tiger0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
dairy0.500000
lymphoma0.500000
cobb broiler chicken0.500000
age 2-7 years0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
formula fed0.500000
age 7 months0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
no immunization: vehicle as control0.500000
c57bc/6ncrl0.500000
state of louisiana0.500000
domestic0.500000
sigmoid colon brushing0.500000
non-celiac gluten sensitivity0.500000
diarrhea0.500000
dog breeding center0.500000
felis silvestris0.500000
wild cat0.500000
indonesia0.500000
municipality of yogyakarta0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
flagstaff0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
puppy0.500000
foxhound0.500000
meat diet0.500000
hydrolized diet0.500000
new zealand0.500000
LOWER IN breast fed0.500000
hispanic or latin american0.500000
type 1 diabetes mellitus0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
bihar state0.500000
gout0.500000
gymnogyps californianus0.500000
california condor0.500000
przewalski horse0.500000
fifth decade human stage0.500000
LOWER IN dog breeding center0.500000
wildlife sactuary0.500000
little physical activity0.500000
LOWER IN no dog0.500000
bedroom0.500000
vegetarian diet0.500000
LOWER IN cron diet0.500000
cast/eij0.500000
LOWER IN diet induced metabolic disease0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
food allergy0.500000
age 4-10 years0.500000
coronary heart disease0.500000
osteoarthritis0.500000
omnivore diet0.500000
sri lanka0.500000
age 1-18 years0.500000
equine grass sickness0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
usa born0.500000
LOWER IN non usa born0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.804255
homo sapiens0.404255
united states of america0.314894
adult0.263830
canis lupus familiaris0.225532
dog0.204255
research facility0.182979
china0.131915
italy0.089362
control0.080851
gallus gallus0.068085
chicken0.068085
male0.068085
LOWER IN control0.063830
child0.063830
mus musculus0.055319
australia0.055319
mouse0.046809
caecum0.046809
city of melbourne0.046809
zoological garden0.038298
captive0.038298
infant0.038298
foxhound0.038298
rectum0.034043
female0.029787
colon0.029787
cobb broiler chicken0.029787
age 35 days0.029787
germany0.029787
formula fed0.029787
felis catus0.029787
cat0.029787
kingdom of spain0.029787
sweden0.029787
israel0.025532
2-5 year-old child stage0.025532
acinonyx jubatus0.025532
obsolete_juvenile stage0.025532
french republic0.025532
wild0.025532
state of north carolina0.021277
broiler chicken0.021277
canis lupus0.021277
wolf0.021277
obesity0.021277
rectal swab0.021277
seattle0.021277
colonized germ free0.021277
farm0.021277
state of new york0.021277
heterosexual0.021277
msw0.021277
zhejiang province0.021277
fourth decade human stage0.021277
rattus norvegicus0.021277
rat0.021277
skin0.021277
russia0.017021
antibiotic0.017021
cheetah0.017021
ovis aries0.017021
age 30 days0.017021
crohn's disease0.017021
ulcerative colitis0.017021
cloaca0.017021
high bmi0.017021
female organism0.017021
adult organism0.017021
state of colorado0.017021
hydrolized diet0.017021
city0.017021
canada0.017021
south africa0.012766
dairy0.012766
commonwealth of pennsylvania0.012766
estonia0.012766
age 2-7 years0.012766
cystic fibrosis0.012766
cftr s489x0.012766
namibia0.012766
state of minnesota0.012766
colonic mucosa0.012766
sigmoid colon0.012766
milan0.012766
sigmoid colon brushing0.012766
panthera leo0.012766
lion0.012766
human adult stage0.012766
indonesia0.012766
municipality of yogyakarta0.012766
midwest region0.012766
mongolia0.012766
winter0.012766
lake hulun0.012766
high fiber0.012766
new zealand0.012766
LOWER IN breast fed0.012766
south korea0.012766
state of california0.012766
Exp. ID User ID Description Date Region Flag Sequences
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v3No1 / 2
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
406amnondominant feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 15
406amnondominant feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 15
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
488amnondominant feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
706amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
766amnondominant n in feces of dog females within 24h after parturition (dominant feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
15amnondominant feces, acinonyx jubatus, namibia2016-11-08v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 21
72amnondominant feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
648amnondominant feces, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 22
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
851amnondominant homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 22
399amnondominant feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
340amnondominant feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
666amnondominant feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 29
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
399amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 36
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
406amnoncommon feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 43
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
645amnoncommon feces, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 49
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
849amnoncommon feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 50
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
15amnoncommon feces, acinonyx jubatus, namibia2016-11-08v4No1 / 55
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
523amnonhigher in houses with dogs ( high in canis lupus familiaris dog compared to no dog in united states of america building air state of illinois chicago bedroom )2019-07-03v4No1 / 59
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in feces united states of america mus musculus mouse )2017-04-14v4No1 / 63
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
822amnon high in hydrolized diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 88
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
15amnoncommon feces, namibia, canis mesomelas2016-11-08v4No1 / 147
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
42amnoncommon in tcr-b deficient balb/c mice (common feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 273
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 325
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681

Problems / suggestions? Please email info AT dbbact DOT org